ID: 1135171340

View in Genome Browser
Species Human (GRCh38)
Location 16:20186708-20186730
Sequence AGCAGGGGTCCTAATGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135171333_1135171340 23 Left 1135171333 16:20186662-20186684 CCTGGAATTTCTGAGCATATTCC No data
Right 1135171340 16:20186708-20186730 AGCAGGGGTCCTAATGCTTCAGG No data
1135171334_1135171340 2 Left 1135171334 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data
Right 1135171340 16:20186708-20186730 AGCAGGGGTCCTAATGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135171340 Original CRISPR AGCAGGGGTCCTAATGCTTC AGG Intergenic
No off target data available for this crispr