ID: 1135171342

View in Genome Browser
Species Human (GRCh38)
Location 16:20186715-20186737
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135171334_1135171342 9 Left 1135171334 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data
Right 1135171342 16:20186715-20186737 GTCCTAATGCTTCAGGTTGGAGG No data
1135171339_1135171342 -9 Left 1135171339 16:20186701-20186723 CCTGGAAAGCAGGGGTCCTAATG No data
Right 1135171342 16:20186715-20186737 GTCCTAATGCTTCAGGTTGGAGG No data
1135171333_1135171342 30 Left 1135171333 16:20186662-20186684 CCTGGAATTTCTGAGCATATTCC No data
Right 1135171342 16:20186715-20186737 GTCCTAATGCTTCAGGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135171342 Original CRISPR GTCCTAATGCTTCAGGTTGG AGG Intergenic