ID: 1135171344

View in Genome Browser
Species Human (GRCh38)
Location 16:20186721-20186743
Sequence ATGCTTCAGGTTGGAGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135171339_1135171344 -3 Left 1135171339 16:20186701-20186723 CCTGGAAAGCAGGGGTCCTAATG No data
Right 1135171344 16:20186721-20186743 ATGCTTCAGGTTGGAGGCTATGG No data
1135171334_1135171344 15 Left 1135171334 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data
Right 1135171344 16:20186721-20186743 ATGCTTCAGGTTGGAGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135171344 Original CRISPR ATGCTTCAGGTTGGAGGCTA TGG Intergenic
No off target data available for this crispr