ID: 1135171345

View in Genome Browser
Species Human (GRCh38)
Location 16:20186722-20186744
Sequence TGCTTCAGGTTGGAGGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135171339_1135171345 -2 Left 1135171339 16:20186701-20186723 CCTGGAAAGCAGGGGTCCTAATG No data
Right 1135171345 16:20186722-20186744 TGCTTCAGGTTGGAGGCTATGGG No data
1135171334_1135171345 16 Left 1135171334 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data
Right 1135171345 16:20186722-20186744 TGCTTCAGGTTGGAGGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135171345 Original CRISPR TGCTTCAGGTTGGAGGCTAT GGG Intergenic