ID: 1135174398

View in Genome Browser
Species Human (GRCh38)
Location 16:20215257-20215279
Sequence CAGGGTAGTTCTGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135174391_1135174398 -9 Left 1135174391 16:20215243-20215265 CCTGGGTGGATTTCCAGGGTAGT No data
Right 1135174398 16:20215257-20215279 CAGGGTAGTTCTGGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135174398 Original CRISPR CAGGGTAGTTCTGGGGAGGA GGG Intergenic
No off target data available for this crispr