ID: 1135176729

View in Genome Browser
Species Human (GRCh38)
Location 16:20236481-20236503
Sequence CCTTCTGTAGATAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135176723_1135176729 12 Left 1135176723 16:20236446-20236468 CCTGAGTTGACTTCCTTTGTCTT No data
Right 1135176729 16:20236481-20236503 CCTTCTGTAGATAAGGTAAAGGG No data
1135176724_1135176729 -1 Left 1135176724 16:20236459-20236481 CCTTTGTCTTGATGCCTAGTCAC No data
Right 1135176729 16:20236481-20236503 CCTTCTGTAGATAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135176729 Original CRISPR CCTTCTGTAGATAAGGTAAA GGG Intergenic
No off target data available for this crispr