ID: 1135177703

View in Genome Browser
Species Human (GRCh38)
Location 16:20245474-20245496
Sequence TCCAGGATAGAAATCAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135177703_1135177708 -1 Left 1135177703 16:20245474-20245496 CCTCCCTTGATTTCTATCCTGGA No data
Right 1135177708 16:20245496-20245518 AAGACTGCAAGGACCCCTGCAGG No data
1135177703_1135177712 26 Left 1135177703 16:20245474-20245496 CCTCCCTTGATTTCTATCCTGGA No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135177703 Original CRISPR TCCAGGATAGAAATCAAGGG AGG (reversed) Intergenic