ID: 1135177703 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:20245474-20245496 |
Sequence | TCCAGGATAGAAATCAAGGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1135177703_1135177708 | -1 | Left | 1135177703 | 16:20245474-20245496 | CCTCCCTTGATTTCTATCCTGGA | No data | ||
Right | 1135177708 | 16:20245496-20245518 | AAGACTGCAAGGACCCCTGCAGG | No data | ||||
1135177703_1135177712 | 26 | Left | 1135177703 | 16:20245474-20245496 | CCTCCCTTGATTTCTATCCTGGA | No data | ||
Right | 1135177712 | 16:20245523-20245545 | TGATGACACTATATAATGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1135177703 | Original CRISPR | TCCAGGATAGAAATCAAGGG AGG (reversed) | Intergenic | ||