ID: 1135177704

View in Genome Browser
Species Human (GRCh38)
Location 16:20245477-20245499
Sequence TCTTCCAGGATAGAAATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135177704_1135177708 -4 Left 1135177704 16:20245477-20245499 CCCTTGATTTCTATCCTGGAAGA No data
Right 1135177708 16:20245496-20245518 AAGACTGCAAGGACCCCTGCAGG No data
1135177704_1135177712 23 Left 1135177704 16:20245477-20245499 CCCTTGATTTCTATCCTGGAAGA No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135177704 Original CRISPR TCTTCCAGGATAGAAATCAA GGG (reversed) Intergenic