ID: 1135177705

View in Genome Browser
Species Human (GRCh38)
Location 16:20245478-20245500
Sequence GTCTTCCAGGATAGAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135177705_1135177708 -5 Left 1135177705 16:20245478-20245500 CCTTGATTTCTATCCTGGAAGAC No data
Right 1135177708 16:20245496-20245518 AAGACTGCAAGGACCCCTGCAGG No data
1135177705_1135177712 22 Left 1135177705 16:20245478-20245500 CCTTGATTTCTATCCTGGAAGAC No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135177705 Original CRISPR GTCTTCCAGGATAGAAATCA AGG (reversed) Intergenic