ID: 1135177707

View in Genome Browser
Species Human (GRCh38)
Location 16:20245491-20245513
Sequence AGGGGTCCTTGCAGTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135177707_1135177712 9 Left 1135177707 16:20245491-20245513 CCTGGAAGACTGCAAGGACCCCT No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135177707 Original CRISPR AGGGGTCCTTGCAGTCTTCC AGG (reversed) Intergenic
No off target data available for this crispr