ID: 1135177708

View in Genome Browser
Species Human (GRCh38)
Location 16:20245496-20245518
Sequence AAGACTGCAAGGACCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135177704_1135177708 -4 Left 1135177704 16:20245477-20245499 CCCTTGATTTCTATCCTGGAAGA No data
Right 1135177708 16:20245496-20245518 AAGACTGCAAGGACCCCTGCAGG No data
1135177705_1135177708 -5 Left 1135177705 16:20245478-20245500 CCTTGATTTCTATCCTGGAAGAC No data
Right 1135177708 16:20245496-20245518 AAGACTGCAAGGACCCCTGCAGG No data
1135177703_1135177708 -1 Left 1135177703 16:20245474-20245496 CCTCCCTTGATTTCTATCCTGGA No data
Right 1135177708 16:20245496-20245518 AAGACTGCAAGGACCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135177708 Original CRISPR AAGACTGCAAGGACCCCTGC AGG Intergenic