ID: 1135177710

View in Genome Browser
Species Human (GRCh38)
Location 16:20245510-20245532
Sequence AGTGTCATCAGCATCCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135177710_1135177712 -10 Left 1135177710 16:20245510-20245532 CCCTGCAGGATGCTGATGACACT No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135177710 Original CRISPR AGTGTCATCAGCATCCTGCA GGG (reversed) Intergenic