ID: 1135177712

View in Genome Browser
Species Human (GRCh38)
Location 16:20245523-20245545
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135177703_1135177712 26 Left 1135177703 16:20245474-20245496 CCTCCCTTGATTTCTATCCTGGA No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data
1135177704_1135177712 23 Left 1135177704 16:20245477-20245499 CCCTTGATTTCTATCCTGGAAGA No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data
1135177710_1135177712 -10 Left 1135177710 16:20245510-20245532 CCCTGCAGGATGCTGATGACACT No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data
1135177705_1135177712 22 Left 1135177705 16:20245478-20245500 CCTTGATTTCTATCCTGGAAGAC No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data
1135177709_1135177712 -9 Left 1135177709 16:20245509-20245531 CCCCTGCAGGATGCTGATGACAC No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data
1135177707_1135177712 9 Left 1135177707 16:20245491-20245513 CCTGGAAGACTGCAAGGACCCCT No data
Right 1135177712 16:20245523-20245545 TGATGACACTATATAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135177712 Original CRISPR TGATGACACTATATAATGAG AGG Intergenic
No off target data available for this crispr