ID: 1135179439

View in Genome Browser
Species Human (GRCh38)
Location 16:20260097-20260119
Sequence AAGAATGATGAGAAGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135179434_1135179439 28 Left 1135179434 16:20260046-20260068 CCACTGATGGGTGGTTTTAAGGA No data
Right 1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135179439 Original CRISPR AAGAATGATGAGAAGAAGGC CGG Intergenic
No off target data available for this crispr