ID: 1135185828

View in Genome Browser
Species Human (GRCh38)
Location 16:20314993-20315015
Sequence ATCCCAGCTCTGCTACTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135185828_1135185832 8 Left 1135185828 16:20314993-20315015 CCAGTCAGTAGCAGAGCTGGGAT No data
Right 1135185832 16:20315024-20315046 CAGTATGTCTGATTCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135185828 Original CRISPR ATCCCAGCTCTGCTACTGAC TGG (reversed) Intronic
No off target data available for this crispr