ID: 1135188037

View in Genome Browser
Species Human (GRCh38)
Location 16:20331926-20331948
Sequence TCCAGAGACCCGTGGGGCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135188031_1135188037 17 Left 1135188031 16:20331886-20331908 CCATCGAAATTGGCTTTCTTCTA No data
Right 1135188037 16:20331926-20331948 TCCAGAGACCCGTGGGGCATCGG No data
1135188033_1135188037 -7 Left 1135188033 16:20331910-20331932 CCACTTGGCGCAGACGTCCAGAG No data
Right 1135188037 16:20331926-20331948 TCCAGAGACCCGTGGGGCATCGG No data
1135188030_1135188037 18 Left 1135188030 16:20331885-20331907 CCCATCGAAATTGGCTTTCTTCT No data
Right 1135188037 16:20331926-20331948 TCCAGAGACCCGTGGGGCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135188037 Original CRISPR TCCAGAGACCCGTGGGGCAT CGG Intergenic
No off target data available for this crispr