ID: 1135190329

View in Genome Browser
Species Human (GRCh38)
Location 16:20349020-20349042
Sequence CAGACGCAGGAGAAGGAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 516}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135190316_1135190329 24 Left 1135190316 16:20348973-20348995 CCACGTCTGTGCAGCCGAGACCG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG 0: 1
1: 0
2: 7
3: 52
4: 516
1135190322_1135190329 4 Left 1135190322 16:20348993-20349015 CCGGGCGACAGGCGGAAGCCTTC 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG 0: 1
1: 0
2: 7
3: 52
4: 516
1135190321_1135190329 10 Left 1135190321 16:20348987-20349009 CCGAGACCGGGCGACAGGCGGAA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG 0: 1
1: 0
2: 7
3: 52
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135190329 Original CRISPR CAGACGCAGGAGAAGGAGCC TGG Exonic
900465770 1:2824807-2824829 CAGAGGGAGGAGAGGCAGCCAGG - Intergenic
900667875 1:3827821-3827843 CAGACGAGGGAGAAAGACCCAGG - Intronic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903680462 1:25093040-25093062 CAGAAGCAGATGAGGGAGCCTGG + Intergenic
904467453 1:30716834-30716856 CAGGCGCAGGTGTAGGAACCGGG + Exonic
904494623 1:30879646-30879668 CAGGGGCAGGAGCCGGAGCCTGG - Intronic
904611723 1:31729483-31729505 TAAAGGCAGGAGAAGGTGCCGGG - Intronic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
905032688 1:34898286-34898308 CAGACTGAGGATAAGCAGCCAGG + Intronic
905309719 1:37041036-37041058 GACACTCAGGAGGAGGAGCCAGG + Intergenic
905850655 1:41272158-41272180 CAGAAGCAGGGGAAGCAGCCAGG - Intergenic
905923927 1:41736633-41736655 CAGATGCAGGCCAAGGAACCAGG + Intronic
906197567 1:43938429-43938451 CAGAGGCAGGAGCTGCAGCCGGG + Intergenic
906356313 1:45108533-45108555 CAGTCTCAAGAGAAGTAGCCAGG - Intronic
906892264 1:49730214-49730236 CAGACACTGGAGAATGAGCAAGG - Intronic
906950158 1:50328515-50328537 CAGACAGAGCAGAAGCAGCCTGG + Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
908780387 1:67685323-67685345 CTGGCACAGGAGGAGGAGCCCGG + Exonic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
911695600 1:100887795-100887817 CTGAGGCAGGAGAATGACCCGGG - Intronic
912144804 1:106780392-106780414 CAGATGCAGGATAAGGTGCAGGG - Intergenic
912153921 1:106892440-106892462 CAGAGGTAGGAGTAGGAGCTGGG - Intergenic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
912956471 1:114157062-114157084 CAGATGCAGGAAGAGGAGCTGGG + Intergenic
913022951 1:114805230-114805252 CTGATGCAGGAGAAGCAGGCAGG + Intergenic
913056560 1:115167123-115167145 CAAAGACAAGAGAAGGAGCCAGG - Intergenic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
913557710 1:119985076-119985098 TAGATGCATGAGAAGGAGACTGG + Intronic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
915342516 1:155184306-155184328 CAGACACGGGAGAAGGAGCAGGG - Exonic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916454122 1:164953069-164953091 CAGGCGCTGGAGAAGCTGCCTGG + Intergenic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
919879942 1:201894811-201894833 CAGGTGCAGGGGAAGGAGCTAGG + Intergenic
920371120 1:205479971-205479993 GAGGGGCAGGAGAAGAAGCCAGG + Intergenic
920415178 1:205794830-205794852 CAGGGGCATGGGAAGGAGCCAGG - Intronic
920968452 1:210721648-210721670 CAGAAGCCGTAGAAGGAGCGGGG + Intronic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
924186888 1:241502174-241502196 CAGCAGCATGAGAAGGAGACAGG + Intronic
924426210 1:243952547-243952569 CAGACGCAGGAGCAGCTGGCTGG + Intergenic
924455470 1:244215562-244215584 GAGGCGGAGGAGGAGGAGCCGGG + Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1063935519 10:11073717-11073739 CTGACTGAGGAGAAGGGGCCAGG + Intronic
1064297370 10:14090518-14090540 CAGACACAGGTGAAGGAGCACGG + Intronic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1067753311 10:48985854-48985876 CAGAGGCAGCAGAGGTAGCCAGG + Intergenic
1068303537 10:55176180-55176202 CTGAGGGAGGAGAAGAAGCCTGG - Intronic
1068806063 10:61195106-61195128 CAGGGGCAGGATAAGGACCCAGG - Intergenic
1069087790 10:64161694-64161716 CTGAAGCAGGAAAAGTAGCCGGG - Intergenic
1069685740 10:70317296-70317318 CAGAAGCAGAAGCAGAAGCCAGG - Intronic
1069906158 10:71733750-71733772 AAGACGAAGGAGTAAGAGCCTGG - Intronic
1070363819 10:75716698-75716720 GAGACACATGAGAAGGAGGCAGG - Intronic
1070882376 10:79861358-79861380 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071198642 10:83191797-83191819 CAGTGGCAGGAGTAAGAGCCAGG + Intergenic
1071648946 10:87377669-87377691 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1073513437 10:104056997-104057019 CAGCCCCAGGAGTAGCAGCCAGG + Exonic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074496702 10:113985924-113985946 CAGAGGCAGGAGAGAGAGACAGG + Intergenic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075579681 10:123607651-123607673 CAGCCGGAGCAGAAGGGGCCAGG - Intergenic
1076302879 10:129441327-129441349 CAGTCTCAGGACGAGGAGCCAGG - Intergenic
1076520027 10:131075644-131075666 CAGACTCAGGAGCCGGACCCAGG - Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076886413 10:133264826-133264848 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886455 10:133265024-133265046 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886509 10:133265263-133265285 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886519 10:133265303-133265325 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077029729 11:459638-459660 CAGACGTGGGAGGAGGAGGCAGG - Intronic
1077614180 11:3663275-3663297 CAGAGCCAGGACAAGAAGCCAGG + Intronic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1079182863 11:18209175-18209197 CCACCGCAGGAGAAAGAGCCGGG - Intronic
1079401717 11:20111296-20111318 CTAAGGCAGGAGAAGGAACCTGG - Intronic
1081793883 11:45806449-45806471 CAGTCATAGGAGAAAGAGCCTGG + Intronic
1083118074 11:60483628-60483650 CAGAGGCAAGTGAAGGATCCTGG - Intergenic
1083386003 11:62310863-62310885 CAGACACAGAAAAAAGAGCCTGG - Intergenic
1083880575 11:65546486-65546508 CAGGTGCAGCGGAAGGAGCCCGG + Exonic
1083935952 11:65870245-65870267 TAGAGGCAGGAGAAGGAGGGCGG + Intronic
1084063502 11:66690388-66690410 AAGAAGCAGGGGGAGGAGCCAGG + Intronic
1084363951 11:68685708-68685730 CAGGCGGAGGGGCAGGAGCCAGG - Intronic
1084577042 11:69995765-69995787 CTGACGGTGGAGAAGCAGCCAGG - Intergenic
1086286112 11:85253479-85253501 TAGAAGCAGGTGCAGGAGCCAGG + Intronic
1086458879 11:86985832-86985854 CATTTGCAGGGGAAGGAGCCTGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1089046321 11:115504308-115504330 CAGAAGCCGGAGCCGGAGCCCGG + Exonic
1089155378 11:116398057-116398079 GAGATGCAGGAGAAGTGGCCAGG + Intergenic
1089188974 11:116640779-116640801 CAGACCCAGGCCAAGAAGCCAGG + Intergenic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1090991878 11:131825096-131825118 CAGAAGCTGGACAAGAAGCCTGG - Intronic
1092123485 12:6060359-6060381 CACACCCAGGGGAAGGAGACCGG + Intronic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092731735 12:11541235-11541257 CATGCCCAGGAGAAGCAGCCCGG - Intergenic
1093245463 12:16730771-16730793 CGGATGCTGGAGAAGGACCCAGG + Intergenic
1094500591 12:31017504-31017526 CATGCCCAGGAGAAGCAGCCCGG + Intergenic
1096226599 12:49870168-49870190 CAGATGCAGGAGAGAGACCCAGG - Exonic
1096476832 12:51913678-51913700 CGGAGGCAGGAGAAGCAGCGTGG + Exonic
1096749312 12:53748643-53748665 CAGAGGCATGAGAAGGTCCCAGG + Intergenic
1096825400 12:54272933-54272955 CAGAGGCAGGACAAGAACCCAGG + Intronic
1096863478 12:54547068-54547090 GAGAGGAATGAGAAGGAGCCTGG + Exonic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099508838 12:83509028-83509050 CAGATGCTGGACAAGGACCCAGG - Intergenic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102594377 12:113981334-113981356 CACACGAAGGAGATGGAGCCAGG + Intergenic
1103401903 12:120649051-120649073 GAGATGGAGGAGGAGGAGCCTGG - Intronic
1103709890 12:122904599-122904621 CACACACAGGAGCAGGGGCCAGG - Intergenic
1103825271 12:123732764-123732786 CAGACGCAGGATGAGGAGACGGG - Intronic
1103904247 12:124319374-124319396 CAGATGGAAGCGAAGGAGCCAGG + Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104575585 12:129963308-129963330 CAGAAGCAGGAGGGGAAGCCAGG - Intergenic
1105034508 12:132908924-132908946 CTGCCGCCGGAGGAGGAGCCCGG + Intronic
1105602784 13:21901978-21902000 GAGAAGCTTGAGAAGGAGCCAGG - Intergenic
1105840802 13:24252217-24252239 CAGACGCAAGGAAAGCAGCCTGG - Intronic
1105977873 13:25489259-25489281 CAGACACAGGAAGAGGAGCCTGG - Intronic
1105991726 13:25628675-25628697 CAGAAGCTGGAGGAGAAGCCTGG - Intronic
1106229746 13:27812732-27812754 CAGAAACAGGAGAGGCAGCCTGG + Intergenic
1106406560 13:29479888-29479910 CAGCGGCTGGAGAAGGAGCTGGG - Intronic
1106614050 13:31310322-31310344 CAGACACTGGAGAGTGAGCCAGG - Intronic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1110370790 13:74737854-74737876 CAGATGGAGGAGGAAGAGCCAGG + Intergenic
1112155729 13:96815190-96815212 CAGACGAAAGAGAAGAGGCCTGG - Intronic
1113651949 13:112039733-112039755 CAGGCTCTGGAGATGGAGCCGGG - Intergenic
1113761844 13:112853602-112853624 CAGACGCTGCAGAAGGTGTCGGG - Intronic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1113952956 13:114081887-114081909 CAGCCCCAGGAGATGCAGCCTGG - Intronic
1113984934 13:114306497-114306519 CTGAGGCAGGAGAATGAACCTGG + Intergenic
1114467219 14:22931539-22931561 CTGAGGCAGGAGAATGACCCAGG + Intergenic
1115460115 14:33650862-33650884 CAGGAGCAGGAGCAGGACCCAGG + Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115642094 14:35341495-35341517 GAGGCCCTGGAGAAGGAGCCTGG - Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116680568 14:47964484-47964506 CAGGAGCAAGAGAAGAAGCCTGG - Intergenic
1117066915 14:52020100-52020122 CAACGGCAGGAGAAGGAACCAGG + Exonic
1117318742 14:54600221-54600243 CATGCTCAGGAGAAGGTGCCTGG - Intronic
1117497518 14:56320128-56320150 CAGAAGCAAGAGAGGGAGCGGGG - Intergenic
1118493320 14:66283177-66283199 CAGAGGCAGGAGAATTGGCCAGG - Intergenic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120469498 14:84904240-84904262 CACATGTTGGAGAAGGAGCCTGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121115361 14:91339248-91339270 CAAAGGTAGGAGAAGCAGCCGGG + Intronic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1122037595 14:98960191-98960213 CAAAGGCAGGCAAAGGAGCCTGG + Intergenic
1122162918 14:99799100-99799122 CACCTGCAGGAGAAGAAGCCAGG - Intronic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122498454 14:102176825-102176847 CTGAGGCAGGAGAATGAACCCGG - Intronic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1123898339 15:24850701-24850723 CAGATGAGGTAGAAGGAGCCTGG + Intronic
1125198388 15:37075033-37075055 CACACACAGGTAAAGGAGCCTGG - Intronic
1125456861 15:39868809-39868831 CATACGAAGGGGCAGGAGCCAGG + Intronic
1125731534 15:41895049-41895071 CAGCCGCTGCAGAAGGGGCCTGG - Intergenic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1126124168 15:45280330-45280352 CATACACAGGACATGGAGCCAGG - Intergenic
1126959752 15:53978370-53978392 CGGCGGCAGGAGAGGGAGCCCGG + Intergenic
1128171477 15:65517449-65517471 CCGGCGCAGGAGAAGGAGAAGGG + Intronic
1128217486 15:65944516-65944538 GAGAGGCAGCAGCAGGAGCCTGG + Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1130137938 15:81197288-81197310 CAGGGGCAGGAGCAGAAGCCAGG + Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1131112980 15:89776877-89776899 CAGACGCAGGCGGAGGGGCAGGG + Exonic
1131344626 15:91634506-91634528 CAGACTCAGGACTAGGAGCCAGG - Intergenic
1131430076 15:92380253-92380275 CAGACCCACCAGAAGGAGGCTGG - Intergenic
1132121486 15:99179733-99179755 CAGAAGCAGGTGGAGGGGCCTGG + Intronic
1132364998 15:101251099-101251121 CGGACGCAGGAGGCGGTGCCCGG + Intronic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1133968971 16:10553485-10553507 CATGCCCAGGAGAAGGTGCCGGG - Intronic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135985059 16:27178020-27178042 CCGAGGCAGGAGAATGAACCCGG + Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136548178 16:30966932-30966954 AAGACGAAGCTGAAGGAGCCTGG + Exonic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1138234499 16:55370558-55370580 CAGCCGCTGGAGAAGGAGGAAGG - Intergenic
1138311508 16:56027412-56027434 CAGATGTAAGAGAATGAGCCTGG - Intergenic
1138330859 16:56214285-56214307 CTGTCACAGGACAAGGAGCCTGG + Intronic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138649363 16:58450296-58450318 AGGATGGAGGAGAAGGAGCCTGG + Intergenic
1138809721 16:60134836-60134858 CATACGCAGGAGAATGAGACTGG - Intergenic
1139237380 16:65354514-65354536 CAGAGGAAGGATAAGGAGCTGGG - Intergenic
1139381855 16:66537444-66537466 CAGAGGCAGGAAACGGAGGCAGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1142304178 16:89276269-89276291 CGGACACAGGAGAGGGAGACAGG + Intronic
1143949720 17:10623014-10623036 TGGACACAGGAGAAGGAGCGGGG + Intergenic
1144506540 17:15836234-15836256 CAGAGGCAGGAGACGGGGCTGGG - Intergenic
1144568824 17:16382104-16382126 CAGACGCAGGACCAGGTGCAGGG - Exonic
1144568860 17:16382332-16382354 CAGACGCAGGACCAGGTGCAGGG - Exonic
1145170714 17:20654166-20654188 CAGAGGCAGGAGACGGGGCTGGG - Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145360088 17:22204744-22204766 CAGACGCAGGACCAGGTGCAGGG - Intronic
1146184898 17:30718333-30718355 GAGACGAAGGAGAAGGTGTCGGG + Intergenic
1146704716 17:34992612-34992634 CAGGAGGTGGAGAAGGAGCCGGG + Exonic
1147119941 17:38330013-38330035 CAGAGGCAGGAGGATGACCCAGG - Exonic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147725555 17:42564331-42564353 GAGTCGGAGGAGGAGGAGCCTGG + Intronic
1147911583 17:43859205-43859227 CAGACTCAGGAGAAAGACCCTGG + Intronic
1148208621 17:45794859-45794881 CAGAGGCAGGAGGCAGAGCCGGG - Intronic
1148432543 17:47653815-47653837 CATACCCATGATAAGGAGCCGGG + Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149542231 17:57476318-57476340 CAGGCTCAGGGGAAGGTGCCAGG - Intronic
1149648103 17:58255007-58255029 CAGAGCCAGGAGTGGGAGCCAGG - Intronic
1149648185 17:58255607-58255629 CAGAGCCAGGAGTGGGAGCCAGG + Intronic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150667255 17:67152829-67152851 CAGAAGCTGGGAAAGGAGCCTGG + Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151657363 17:75502270-75502292 GACACGGAGGAGGAGGAGCCAGG - Exonic
1151980021 17:77503164-77503186 CAGAGGCAGGAGAAGCGGCGGGG - Intergenic
1152161836 17:78673664-78673686 CAGAAGCAGGGGAAGGCGCTTGG - Intergenic
1152456897 17:80421927-80421949 CAGCTGCGGGAGAAGGAGCCGGG + Exonic
1152657644 17:81527407-81527429 CTGAGGCAGGTGCAGGAGCCAGG + Intergenic
1152877490 17:82795390-82795412 CGGACGCAGGACAAAGATCCGGG - Intronic
1152885216 17:82845462-82845484 CAGACGGAGAGGAAGGGGCCGGG - Intronic
1153673647 18:7436340-7436362 GCCACGCAGGAGAAGGAGCATGG - Intergenic
1153788766 18:8558334-8558356 CAGATTCAGGAGAATCAGCCAGG - Intergenic
1155558335 18:27047094-27047116 CAGAGGCAGGACAAGGACTCAGG - Intronic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1157090181 18:44627635-44627657 CAGTCTCAGGAGATGGGGCCTGG + Intergenic
1157392438 18:47314018-47314040 CAGAGGCTGGAGAAGAGGCCAGG - Intergenic
1157562667 18:48659749-48659771 GAGAGGAAGGAGAAGCAGCCTGG + Intronic
1158134995 18:54198335-54198357 TAAAAGCAGGAGAAGGAGCTTGG - Intronic
1160072891 18:75643676-75643698 CAGCAGCAGGTGAGGGAGCCAGG - Intergenic
1160881816 19:1324438-1324460 CAGAAGGGCGAGAAGGAGCCAGG + Intergenic
1160949417 19:1658365-1658387 CAGGTGCAGGTGAAGGAGCCTGG - Intergenic
1161317847 19:3626603-3626625 CAGACGGAGGCGGCGGAGCCGGG - Exonic
1161610546 19:5240053-5240075 GAGACGCAGGAGAAGCAGAAGGG + Intronic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1162541110 19:11296503-11296525 CAGACGGAGGAGGAGGAGCAGGG + Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162738730 19:12761624-12761646 CTGAGGCAGGAGAATGAACCCGG - Intergenic
1162744327 19:12790303-12790325 CAGCCCCGGGGGAAGGAGCCCGG - Intronic
1162797937 19:13096149-13096171 GAGACGCAGGAGGAGGAGTAAGG - Exonic
1163085873 19:14979568-14979590 CGGATGCAGGAGCCGGAGCCCGG + Intronic
1163632457 19:18424418-18424440 CAGATGGAGGAGACGGAGCAGGG + Intronic
1164054892 19:21614388-21614410 CTGAGGCAGGAGAATCAGCCAGG - Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1165227717 19:34366098-34366120 CAGACCCTGGATGAGGAGCCCGG - Intronic
1165360251 19:35332057-35332079 CTTACCCAGGAGCAGGAGCCAGG - Exonic
1165442110 19:35834790-35834812 CTGAGGCAGGAGAGGAAGCCGGG + Intronic
1165462829 19:35954125-35954147 CAGAGGCAGGAGAGGGCACCAGG - Intergenic
1165726579 19:38117109-38117131 CAGAAGCAGGAGAGGTAACCAGG - Intronic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1166110150 19:40617159-40617181 CAGAGGCACTGGAAGGAGCCGGG - Exonic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166416087 19:42595786-42595808 GAGATCCAGGAGAGGGAGCCTGG + Intronic
1166432831 19:42741344-42741366 GAGATGCAGGAGGGGGAGCCTGG + Intronic
1166445815 19:42856599-42856621 GAGACGCAGGAGGGGGAGCCTGG + Intronic
1166453200 19:42918747-42918769 GAGACGCAGGAGGGGGAGCCTGG + Intronic
1166455685 19:42938058-42938080 GAGACACAGGAGGGGGAGCCTGG + Intronic
1166465478 19:43027333-43027355 GAGACGCAGGAGGAGGAGCCTGG + Intronic
1166471614 19:43083537-43083559 GAGACGCAGGAGGGGGAACCTGG + Intronic
1166482758 19:43187353-43187375 GAGACGCAGGAGGGGGAGCCTGG + Intronic
1166485232 19:43206487-43206509 GAGACGCAGGAGGGGGAGCCTGG + Intronic
1166492382 19:43270405-43270427 GAGACGCAGGAGGGGGAGCCTGG + Intergenic
1167349856 19:48967894-48967916 CAGACCCAGGGGAAGGAGAAGGG - Intergenic
1167353726 19:48991438-48991460 CAGACGAAGGCGAAGGTGACAGG - Exonic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1168105007 19:54161168-54161190 CAGACCCAGGAGAAGGACCAAGG + Exonic
924981712 2:228720-228742 CAGACGCAGGGGCAGGAGGCAGG + Intronic
925060249 2:885381-885403 CAGCCCCAGGACATGGAGCCTGG + Intergenic
925423289 2:3728851-3728873 CAGATGCTGGAGAGAGAGCCCGG + Intronic
925914980 2:8598303-8598325 CAGAGGCAGGAGAGGAAGCTGGG + Intergenic
926213587 2:10889822-10889844 CAGAAGCTGTAGGAGGAGCCAGG + Intergenic
926218437 2:10919726-10919748 CAGACGCACCAGCAGAAGCCCGG - Intergenic
926764630 2:16313488-16313510 CAGACGCATGAGAGGGAGCGTGG + Intergenic
927562810 2:24085301-24085323 CAGCCCCAGGAGAAGGATGCTGG + Intronic
927855268 2:26523804-26523826 CTGCCCCATGAGAAGGAGCCTGG + Intronic
928140413 2:28723774-28723796 CAGACGCAGCAAGAGAAGCCAGG + Intergenic
929233518 2:39584047-39584069 CAGCCTCAGTAAAAGGAGCCTGG + Intergenic
929427346 2:41856684-41856706 CAGACGCAGTAGAGAGAGGCAGG - Intergenic
929462997 2:42118307-42118329 CAGAAGCAGGAGAAAGACCTAGG - Intergenic
929589302 2:43134692-43134714 CAGGGGCAGGGGAAGGAGCGGGG - Intergenic
931932146 2:67150543-67150565 CTGAGGCAGGAGAATGAACCTGG + Intergenic
933161106 2:79026140-79026162 CTGACACAGGAGAATGAGGCAGG - Exonic
933730481 2:85452457-85452479 CAGTGGCAGGAAATGGAGCCAGG - Intergenic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
935646216 2:105337450-105337472 CAGCAGCGAGAGAAGGAGCCCGG + Exonic
936154638 2:110040071-110040093 CAGATGCAGCAGGAGAAGCCTGG - Intergenic
936190045 2:110331343-110331365 CAGATGCAGCAGGAGAAGCCTGG + Intergenic
937045040 2:118846745-118846767 GAGGCGCAGGAGGAGGAGGCCGG - Exonic
937235886 2:120431791-120431813 CAGAGACGGGACAAGGAGCCTGG - Intergenic
937258008 2:120568359-120568381 CTGACACAGCAGGAGGAGCCAGG - Intergenic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
938899432 2:135787405-135787427 CAGACGAAGGAGAATCTGCCTGG + Intergenic
938962377 2:136354996-136355018 CAGACCGGGGAGGAGGAGCCAGG + Intergenic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
940047537 2:149425165-149425187 GAGACGCAGGAAGAGGATCCAGG - Intronic
940048696 2:149437731-149437753 CAGGCTCAGGAGCAGGAGCCAGG - Exonic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
942625302 2:177894095-177894117 CACATTCAGGAGAAGAAGCCAGG - Intronic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
944565597 2:200987307-200987329 CAGTTGCTGGAGAAGGATCCTGG - Intronic
946035174 2:216736274-216736296 GAGACGCAGTAGAAGGAGTTAGG + Intergenic
946332474 2:219018185-219018207 CAGACTTAGGAGAGGGATCCAGG - Intronic
947525630 2:230875163-230875185 CAGACACCAGAGAAAGAGCCTGG - Intronic
948175607 2:235940238-235940260 CCGACGCAGCAGAAGGACCAGGG - Intronic
948293223 2:236842763-236842785 GGGAGGCAGGAGAAGAAGCCAGG - Intergenic
948479603 2:238241161-238241183 CTGACGCCGGGGCAGGAGCCGGG - Intergenic
948504263 2:238417715-238417737 CACACGCAGGAGAAGGGCGCAGG - Intergenic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
949032387 2:241803189-241803211 CTGCCGCACGAGAAGGCGCCAGG + Intronic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1170477446 20:16730013-16730035 CAAAAGCAGGAAACGGAGCCAGG - Exonic
1170843516 20:19943115-19943137 AACAGGCAGAAGAAGGAGCCAGG - Intronic
1171175444 20:23048576-23048598 CACATGCACGAGTAGGAGCCCGG + Exonic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1172145368 20:32754038-32754060 CAGACTCAGGTGAAGAAGACAGG - Intergenic
1172952026 20:38728479-38728501 CAGGCGCAGGTGAAAGAGGCTGG - Exonic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174468756 20:50739346-50739368 CTGAGGCAGGAGAATCAGCCAGG + Intronic
1174519597 20:51119318-51119340 CAGAAGCAGGACCGGGAGCCAGG + Intergenic
1174657234 20:52181751-52181773 CAGATTCAGGAGGTGGAGCCCGG + Intronic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175219357 20:57408127-57408149 GAGAGGCAGGAGAAGGTGCAAGG - Exonic
1175293410 20:57893212-57893234 CAGAGGCAAGACAAGGAACCAGG - Intergenic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176176497 20:63728831-63728853 CTGACTCAGGAGTAGGAGCCAGG + Intronic
1176293859 21:5060235-5060257 CAGACGCTGGAGAAGGCGGGAGG - Intergenic
1177368276 21:20167711-20167733 GAGAAGCAGGGGAAGGTGCCAGG + Intergenic
1177546151 21:22561705-22561727 TAGACGCAGGACAAGAACCCAGG + Intergenic
1178620687 21:34171767-34171789 CATGCTCAGGAGAAGGAGCAAGG - Intergenic
1179213835 21:39349316-39349338 CAGACCCAGGCGAAGGGGGCGGG + Intronic
1179334546 21:40438081-40438103 CAGACCCAGGACCAGGAGTCTGG + Intronic
1179371357 21:40808926-40808948 TAGGCGCAGGTTAAGGAGCCTGG - Intronic
1179510952 21:41873169-41873191 CACATGCAGGAGAAGGAACCAGG - Intronic
1179571099 21:42279365-42279387 CAGACGCAGGAGGCGGAGGGCGG + Intronic
1179863400 21:44203413-44203435 CAGACGCTGGAGAAGGCGGGAGG + Intergenic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1179969514 21:44826424-44826446 TAGATGGAGGAGAAGGAGACAGG + Intergenic
1180248199 21:46562440-46562462 CAGAGGCAAGGGAAGGAGCTTGG + Intronic
1180711436 22:17842154-17842176 CAGAGGCCAGAGAAGGACCCTGG + Intronic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG + Intronic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182364208 22:29766972-29766994 AGGACGCAGGAGGAGGAGCCCGG - Intronic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182511746 22:30824929-30824951 CAGAGTCAGGACAAGAAGCCAGG - Intronic
1182551754 22:31104515-31104537 CACAGGCAGGAGACGGTGCCCGG - Exonic
1182573142 22:31254173-31254195 CAGGCCCAGGAGAGGGAGCAGGG - Intronic
1183103139 22:35596271-35596293 AGGACCCAGGAGAAGGAGCCTGG - Intergenic
1183186464 22:36294249-36294271 CAGACTCTGGAGAACGAGCGGGG - Exonic
1183529834 22:38347392-38347414 CAGGGGCATGAGCAGGAGCCTGG + Intronic
1184402623 22:44282588-44282610 CATTCGCAGGAGAAAGAGCTGGG + Intronic
1184552476 22:45211923-45211945 CAGACGCAGGGGCAGGGGCCGGG + Intronic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184970805 22:48018711-48018733 CAGACACAAGGGAAGGAGCCTGG - Intergenic
1185045136 22:48524950-48524972 AAGAGGCAGGAGAAAGGGCCAGG - Intronic
1185372082 22:50465631-50465653 CAGTAGCAGAAGCAGGAGCCTGG - Intronic
950798507 3:15530734-15530756 CAGACACAGGTGCAGGTGCCAGG + Intergenic
950929358 3:16773718-16773740 GAGAGGCAGGAGCAGGAACCGGG + Intergenic
951713324 3:25609567-25609589 AAGAGGGAGAAGAAGGAGCCTGG - Exonic
953151773 3:40331590-40331612 GGGACCCAGGAGGAGGAGCCTGG + Intergenic
954861547 3:53694846-53694868 CAGTCACAGGTGAAGGACCCTGG + Intronic
955496860 3:59542517-59542539 CTGAGGCATGAGGAGGAGCCAGG + Intergenic
956007675 3:64798140-64798162 CAGACCAAGTAGAAGGACCCAGG - Intergenic
956748933 3:72331236-72331258 TAGACGCAGAAGAACGAACCTGG + Intergenic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
961623058 3:128239847-128239869 CAGTCACAGGAGAAGGCTCCAGG - Intronic
961954493 3:130787546-130787568 CACCCGCAGGAGAAGGAGGGTGG + Intergenic
962509264 3:136082605-136082627 CAGATGTAGGAGAAGGAGTTTGG + Intronic
963283708 3:143412479-143412501 CAAACACCGGAGAAGGAGCCTGG - Intronic
964413501 3:156423812-156423834 CAGAGTCAGGAAAATGAGCCAGG + Intronic
966422559 3:179747682-179747704 TAGACACAGGAGAAGAATCCAGG - Intronic
967389665 3:188943223-188943245 CAGATCCAGGTGCAGGAGCCAGG - Intergenic
967969405 3:194988040-194988062 ATGACGCAGGAAAAGGGGCCTGG + Intergenic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968450735 4:674881-674903 CAGCCGCAGGAAGAGGGGCCTGG - Intronic
969313191 4:6366303-6366325 AAAGTGCAGGAGAAGGAGCCCGG - Intronic
969375920 4:6763092-6763114 CTCATCCAGGAGAAGGAGCCAGG - Intergenic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
969854895 4:9991173-9991195 AAGCAGCAGGGGAAGGAGCCAGG - Intronic
970170386 4:13283505-13283527 GAGAGGCCGGAGAAGGTGCCTGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971139316 4:23906512-23906534 CTGAGGCAGGAGAAGAACCCAGG + Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
972850437 4:43042542-43042564 GAGAGACAGGAGGAGGAGCCAGG - Intergenic
973601276 4:52545250-52545272 CAGACTCAGGAGGAGGGGCTGGG - Intergenic
973742074 4:53927690-53927712 CAGAGGCTGGAGAAGCAGCAGGG + Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
981550492 4:145937380-145937402 CAGTCGGAGCAGACGGAGCCGGG - Intronic
981724699 4:147834797-147834819 CTGACCCAGGGGAAGGAGACAGG - Intronic
982325770 4:154126999-154127021 GACAGGCAGGAGCAGGAGCCAGG + Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
983826912 4:172273905-172273927 CAGAAGCAAGAGAAGCAGTCAGG + Intronic
985089479 4:186348673-186348695 CAGAAGCTGGGGAGGGAGCCTGG - Intergenic
985293229 4:188407299-188407321 CACAGGCAGGTGCAGGAGCCAGG - Intergenic
985471889 5:51700-51722 CAGACGTGGGAGACGCAGCCGGG - Intergenic
985622393 5:962453-962475 CAGATGCCAGGGAAGGAGCCTGG + Intergenic
985769483 5:1799809-1799831 CAGACGCAGGGGTCGGCGCCGGG - Exonic
985887921 5:2694556-2694578 CAGAGGCAGGGGTAGGAGCAAGG + Intergenic
985939318 5:3121800-3121822 CAGACACAGGTGACGGGGCCTGG + Intergenic
986061864 5:4199256-4199278 CAGACCCAGGGAGAGGAGCCAGG - Intergenic
986163293 5:5250578-5250600 CAGGCCCAGGAGCAGGACCCTGG + Intronic
987038220 5:14038601-14038623 CAGAGGCAGGATGAGGACCCAGG + Intergenic
989034746 5:37158880-37158902 CTGAGGCAGGAGAATGAACCCGG - Intronic
990513870 5:56514508-56514530 CAGAGACAGGGGAAGGTGCCAGG - Intronic
991589196 5:68231324-68231346 CAGAGGCTGCAGGAGGAGCCAGG - Intronic
991945550 5:71895307-71895329 CAGACACAGGTCCAGGAGCCAGG - Intergenic
994082023 5:95717602-95717624 CAGAGGCAGCAGAATGAGACAGG - Intronic
994320717 5:98392013-98392035 CAGCCGCAGGAGCAGTAGTCTGG + Intergenic
994758112 5:103819333-103819355 CTGAGGCAGGAGAGGGAGACAGG + Intergenic
996057580 5:118998588-118998610 CTGAGGCAGGAGAATCAGCCAGG - Intergenic
996714009 5:126571850-126571872 CAGACACAAAAGAAGGAGCTGGG + Intronic
996882689 5:128317859-128317881 CAAACACTGGACAAGGAGCCAGG + Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998791186 5:145767428-145767450 TGGATGCAGGACAAGGAGCCGGG + Intronic
998888039 5:146715177-146715199 CAGACCCAGGTGATGGTGCCAGG + Intronic
999089170 5:148920563-148920585 CAGATGGAAGAGAGGGAGCCAGG + Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1002159927 5:177309059-177309081 AAGACACAGCAGAGGGAGCCTGG + Intronic
1002168650 5:177363092-177363114 CAGCCGGGGGAGGAGGAGCCCGG + Intronic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1002758446 6:183321-183343 CAGAGGCAGGAGAACGGGCAAGG - Intergenic
1002861362 6:1082389-1082411 CAGAACCAGGAGCAGGACCCAGG + Intergenic
1002971102 6:2021041-2021063 CAAATGCAGGAGAAGCAGCTGGG - Intronic
1003158514 6:3616657-3616679 CAGGCACAGGAAAAGGATCCAGG + Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1006021918 6:31122367-31122389 GAGACTCAGGAAAGGGAGCCTGG - Intronic
1006189823 6:32201044-32201066 CAGAGGGAGGAAAGGGAGCCAGG - Intronic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006192745 6:32219714-32219736 CAGAGGCAGTTGAAGGAGCCAGG + Exonic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006860801 6:37170510-37170532 CTGCCGCAGGAGCCGGAGCCGGG - Exonic
1007418041 6:41703428-41703450 CAGGAGCAGGGGCAGGAGCCAGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011517259 6:88167024-88167046 CGGGCGCTGGAGAAGGCGCCTGG - Intergenic
1012767553 6:103387589-103387611 CAGCCACAGGAGGAGGAGCTGGG + Intergenic
1012769261 6:103408021-103408043 CAGTCTCAGGAAAAGGAGACAGG - Intergenic
1012986675 6:105883550-105883572 CAGATGCAGCTGAAGGTGCCGGG + Intergenic
1013552785 6:111225455-111225477 CTGAGGCAGGAGAAGAATCCAGG + Intronic
1013572715 6:111445805-111445827 CAGACATAGGAAAAGGAGACTGG + Intronic
1013760420 6:113511327-113511349 CAGACAGAGGAAAAGGAGCATGG - Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1013940996 6:115662443-115662465 CAGGCACTGGAGTAGGAGCCAGG + Intergenic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1016056244 6:139580439-139580461 TAGACGCAGGAGGAGAAGCAGGG + Intergenic
1016406964 6:143741147-143741169 CTGAGGCAGGAGAATGAGTCAGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017027148 6:150191239-150191261 GCAACGCAGGAAAAGGAGCCAGG - Intronic
1017649122 6:156564939-156564961 CAGACGCAGAACCAGCAGCCGGG - Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018429675 6:163713324-163713346 CCCACGCAGGAGAGGGTGCCTGG + Intergenic
1018648966 6:165975050-165975072 TGGAGGCAGGAGAAGGAGCCCGG + Intronic
1018903146 6:168061110-168061132 CTGATGCAGGAGGAAGAGCCCGG + Intronic
1018964577 6:168474444-168474466 CAGACGCAGGAGCTGGAGCCTGG - Intronic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019357910 7:590562-590584 CAGACGCAGGAGATGCAGGTGGG + Intronic
1019494755 7:1332514-1332536 CAGCCCTAGGAGAGGGAGCCAGG - Intergenic
1019519853 7:1455655-1455677 CAGAGGCAGAACCAGGAGCCCGG + Intronic
1019554274 7:1620885-1620907 CAACCGCAGGAGAAACAGCCGGG + Intergenic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1019943397 7:4308539-4308561 CAGAAGCTGGAGAGGGACCCGGG - Intergenic
1020137320 7:5594392-5594414 CAGACGCGGGAGGAGGGGCTGGG - Intronic
1022282015 7:28920453-28920475 GAGACGCAGGAGAAGGAGATGGG - Intergenic
1023044035 7:36196508-36196530 CTGACGCAGGAGAATCAGGCAGG - Intronic
1023658201 7:42447397-42447419 CAGAAGGAGGAGAAAGATCCTGG - Intergenic
1024522180 7:50315073-50315095 CAGAAGCCGGACTAGGAGCCGGG - Intronic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1026530910 7:71196433-71196455 CAGAAGCAGAAGAAGGGGCCAGG - Intronic
1027575138 7:79922135-79922157 AACAAGCAGGAGAGGGAGCCTGG + Intergenic
1029292154 7:99510330-99510352 CTGACGCAGGAGAATCAACCCGG - Intronic
1029837583 7:103329377-103329399 CAGACGCAGGCTGAGGAGTCAGG - Intronic
1029981799 7:104885911-104885933 CAGAGGCAGGAGAAATAGCAGGG - Intronic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033492367 7:141855796-141855818 CAGCCACAGGAGCAGGAGCTAGG - Intergenic
1033750874 7:144360207-144360229 CTGAGGCAGGAGAGGGATCCTGG - Intronic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1035340517 7:158157761-158157783 CAGGCGCAGGAGAGGGCACCCGG - Intronic
1035529741 8:341747-341769 CAGACCAAGGAGAAGAATCCAGG + Intergenic
1035670373 8:1412342-1412364 GAGATGGAGGAGAAAGAGCCCGG - Intergenic
1036453955 8:8892517-8892539 GAGAGGCAGGAGAGGGAGTCAGG + Exonic
1036620441 8:10421710-10421732 CAGATGCACGAAAAGCAGCCGGG - Intronic
1038423753 8:27451482-27451504 CAGACGCCAGAGAAGGAGGTCGG + Exonic
1038450860 8:27637907-27637929 CAGGGGCACGGGAAGGAGCCAGG + Intronic
1040478511 8:47802574-47802596 CTGAGGCAGGAGAATGAACCTGG - Intronic
1041135813 8:54757639-54757661 CAGACACAGAAGCAGGAGACAGG + Intergenic
1041167268 8:55102353-55102375 CCGACGCAGGAGCAGGAGGAGGG + Intergenic
1041277706 8:56179991-56180013 CAGAGGCAGAATAAGGAGCCAGG + Intronic
1042642426 8:70951121-70951143 CAGGCTCAGGAGAAAGGGCCTGG + Intergenic
1042926968 8:73976457-73976479 CGGACGCCGGAGAAGGCGCGCGG - Exonic
1043519141 8:81025721-81025743 CAGCCACAGGAGGAGGTGCCTGG + Intronic
1045488734 8:102654488-102654510 CAGATGCGGGAGGAGGAGCCAGG + Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1048580000 8:135722895-135722917 CAGCCGCAAGAGAAGAGGCCGGG + Intergenic
1048975757 8:139672244-139672266 CAGAGGCAGGAGCAGGACCAGGG + Intronic
1048999292 8:139814448-139814470 CAGGCCCAGGAAAAGGACCCCGG + Intronic
1049391486 8:142373805-142373827 CACACACAGGAGAGGGAGCTAGG + Intronic
1049439259 8:142601770-142601792 CAGACGAACTAGCAGGAGCCCGG + Intergenic
1049620496 8:143596288-143596310 CAGAGGCAGGTCTAGGAGCCTGG + Intronic
1049654019 8:143789857-143789879 CAGACGCAGGAGGGTGGGCCTGG + Intergenic
1051667428 9:19478193-19478215 GAGACTCAGGGGAAGGAACCGGG + Intergenic
1053299344 9:36937569-36937591 CAAACACAGGAAGAGGAGCCTGG - Intronic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1056575955 9:87856321-87856343 CAGAGGTAGGAGGAGGAGCTGGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057619146 9:96619540-96619562 CAGGAGCCGGAGGAGGAGCCCGG + Exonic
1058745821 9:107989623-107989645 CAGAGGCTGGAGAAGAAACCAGG - Intergenic
1059208475 9:112487460-112487482 CAGACCCAAGAGCAGGAGCGGGG - Intronic
1059421743 9:114196533-114196555 CAGAAGCAGGAGTAGGACCCAGG - Intronic
1060600057 9:124871231-124871253 CAGATGGAGTAGAAGGAACCCGG + Intronic
1060819289 9:126652101-126652123 CAGACCCAGGTGGAGGGGCCCGG + Intronic
1061412139 9:130427553-130427575 CAGGTGCAGGAGAAGCGGCCGGG - Exonic
1061543573 9:131290936-131290958 CAGACCCTGGGGAAGAAGCCTGG - Intronic
1061825742 9:133257184-133257206 CAGCCTCTGGAGAAGGAGCTGGG + Intronic
1062098936 9:134717982-134718004 CAGCAGCATGAGAAGCAGCCTGG + Intronic
1062457661 9:136647038-136647060 CAGATGCCGGAGGAGCAGCCAGG - Intergenic
1062676974 9:137752415-137752437 CAGACGCAGGAGGAGGCGCTGGG - Intronic
1185553468 X:1002245-1002267 CAGACCCTGGAGAAGGAGAGGGG + Intergenic
1185748317 X:2589785-2589807 CAGATCCAGGAGACAGAGCCAGG - Intergenic
1185821800 X:3212274-3212296 CAGAAGCAGGAGCAAGAGCGGGG - Intergenic
1186382449 X:9075011-9075033 CAGAGGCAGGAGAAGCAGGTAGG + Intronic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1187293914 X:17980943-17980965 GAGAGGCAGGAGAAGGGGCAGGG - Intergenic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1188179312 X:27034536-27034558 CTTATGCAGGAGATGGAGCCTGG - Intergenic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1190877260 X:54468787-54468809 CTGATCCAGGAGATGGAGCCTGG + Exonic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193793065 X:85840521-85840543 CAGAGCCAGGATTAGGAGCCAGG - Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1196434746 X:115664792-115664814 CAGTGGCAGGAGATGGAGCAGGG - Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1198600939 X:138283350-138283372 CTGACGCAGGAGAATCAGGCAGG + Intergenic
1199819301 X:151428833-151428855 CAGAAGCAGGAAGAGTAGCCAGG - Intergenic
1200076825 X:153555300-153555322 GACACGCAGGAGTGGGAGCCAGG - Intronic
1200365176 X:155655552-155655574 CATACGCAGAAGAATGAACCTGG - Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1201257135 Y:12119368-12119390 CAGAAGCAGGAGCAAGAGCGGGG + Intergenic