ID: 1135191501

View in Genome Browser
Species Human (GRCh38)
Location 16:20358238-20358260
Sequence CAGTGGAGATGAAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135191493_1135191501 17 Left 1135191493 16:20358198-20358220 CCAGTTAGGAGACTTCAGCTGAG No data
Right 1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135191501 Original CRISPR CAGTGGAGATGAAGGGAAGT GGG Intergenic
No off target data available for this crispr