ID: 1135194907

View in Genome Browser
Species Human (GRCh38)
Location 16:20386406-20386428
Sequence AGATGGACCACGGGGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135194907_1135194918 19 Left 1135194907 16:20386406-20386428 CCGCCCACCCCCGTGGTCCATCT No data
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data
1135194907_1135194917 18 Left 1135194907 16:20386406-20386428 CCGCCCACCCCCGTGGTCCATCT No data
Right 1135194917 16:20386447-20386469 GCAAATGACCTCTGCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135194907 Original CRISPR AGATGGACCACGGGGGTGGG CGG (reversed) Intronic
No off target data available for this crispr