ID: 1135194910 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:20386410-20386432 |
| Sequence | CTCCAGATGGACCACGGGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1135194910_1135194917 | 14 | Left | 1135194910 | 16:20386410-20386432 | CCACCCCCGTGGTCCATCTGGAG | No data | ||
| Right | 1135194917 | 16:20386447-20386469 | GCAAATGACCTCTGCTGCAGAGG | No data | ||||
| 1135194910_1135194918 | 15 | Left | 1135194910 | 16:20386410-20386432 | CCACCCCCGTGGTCCATCTGGAG | No data | ||
| Right | 1135194918 | 16:20386448-20386470 | CAAATGACCTCTGCTGCAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1135194910 | Original CRISPR | CTCCAGATGGACCACGGGGG TGG (reversed) | Intronic | ||