ID: 1135194911

View in Genome Browser
Species Human (GRCh38)
Location 16:20386413-20386435
Sequence GTGCTCCAGATGGACCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135194911_1135194918 12 Left 1135194911 16:20386413-20386435 CCCCCGTGGTCCATCTGGAGCAC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data
1135194911_1135194917 11 Left 1135194911 16:20386413-20386435 CCCCCGTGGTCCATCTGGAGCAC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1135194917 16:20386447-20386469 GCAAATGACCTCTGCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135194911 Original CRISPR GTGCTCCAGATGGACCACGG GGG (reversed) Intronic
900925605 1:5704325-5704347 GTGCTCCAGCAGGTCCCCGGAGG - Intergenic
902561971 1:17283179-17283201 AGGCTCCAGATGGAACACTGAGG + Exonic
905271504 1:36790576-36790598 TTGCTCCAGATGGACCTGAGTGG + Intergenic
906484337 1:46222636-46222658 TTGCTCCAGAAGGACCGGGGTGG - Intergenic
1063421485 10:5915964-5915986 GGGCTCCAGAAGGTCCCCGGAGG - Intronic
1068736416 10:60418190-60418212 GTGCTTCAGATGGACCATTCTGG - Intronic
1069356954 10:67597780-67597802 GTGCTCCAGTGGCACCAGGGTGG + Intronic
1073613748 10:104971540-104971562 GAGCTCCAGATGCCCCACAGTGG - Intronic
1074198092 10:111207055-111207077 GTCCTCCAGGTGGAGCACGGTGG - Intergenic
1076117346 10:127909385-127909407 GTGGTGCAGATGGAGCACAGTGG - Intronic
1078667287 11:13336584-13336606 GCTCTCCAGTTGGACCACGAGGG + Intronic
1089582343 11:119489297-119489319 GGGGTCCTGATGGACCAGGGTGG + Intergenic
1090254174 11:125271733-125271755 GTGCTCCTTATGGACCCTGGGGG - Intronic
1095815133 12:46413093-46413115 GTGCCACAGATGGACCACACTGG - Intergenic
1115383712 14:32770664-32770686 GTGAACCAGATGGACCAAGATGG - Intronic
1119379635 14:74220221-74220243 TTGGTCCAGACGGTCCACGGAGG + Intergenic
1121403427 14:93702930-93702952 GTGCTCCAGACAGATCACCGTGG - Intronic
1121529659 14:94643609-94643631 GTGCTGCGGATGGACCACGCTGG + Intergenic
1122046868 14:99030082-99030104 CTGCTGCAGATGCACCATGGGGG - Intergenic
1122955377 14:105067944-105067966 CTGCTCCAGATGCACCAGGTGGG - Intergenic
1123068595 14:105630234-105630256 GTGCTCCAGAAGGAACAAGATGG + Intergenic
1123072594 14:105649035-105649057 GTGCTCCAGAAGGAACAAGATGG + Intergenic
1123092618 14:105748561-105748583 GTGCTCCAGAAGGAACAAGATGG + Intergenic
1123098178 14:105776262-105776284 GTGCTCCAGAAGGAACAAGATGG + Intergenic
1123783057 15:23645802-23645824 CTGCTCCAGCTGGACCAAGGGGG + Exonic
1128720193 15:69942281-69942303 GTGTTCCAGAAGCACCAGGGAGG - Intergenic
1130989605 15:88868430-88868452 GCTCTCCAGATGAACCTCGGGGG - Intronic
1132793414 16:1706346-1706368 GAGATCCAGATGGACGAGGGCGG + Exonic
1132958409 16:2608833-2608855 ATGCTTCAGGTGAACCACGGGGG - Intergenic
1132971021 16:2688929-2688951 ATGCTTCAGGTGAACCACGGGGG - Intronic
1133270738 16:4609785-4609807 GGCCTCCAGCTGGCCCACGGCGG - Exonic
1135194911 16:20386413-20386435 GTGCTCCAGATGGACCACGGGGG - Intronic
1136655518 16:31706871-31706893 GGGCTGCAGAGGGACCAGGGAGG - Intergenic
1141095181 16:81158180-81158202 GAGCACCAGGTGCACCACGGGGG - Intergenic
1141748733 16:85944107-85944129 CTGCTCTGGATGGACCAAGGTGG + Intergenic
1141910099 16:87053084-87053106 GTGCCCCACATGGCCCTCGGAGG - Intergenic
1143291152 17:5830167-5830189 CTGCTCCAGGTGGTCCAGGGAGG - Intronic
1143748717 17:9012753-9012775 GTGCTTCTGATGTACCACAGTGG + Intergenic
1152708538 17:81858629-81858651 GTGCTACAGACGGAGCAGGGCGG + Intronic
1152794656 17:82301159-82301181 GGGTTCCAGATGGGCCTCGGGGG + Intergenic
1153654574 18:7271623-7271645 ATACTCCAGATGTTCCACGGAGG + Intergenic
1162259125 19:9518247-9518269 GTGCTTCAGATGCCCCACGATGG - Intergenic
1165454443 19:35902589-35902611 GTGACCCAGATGGATCATGGTGG - Exonic
1166587864 19:43967153-43967175 ATGCACCAGAGGGTCCACGGGGG + Exonic
925072833 2:984537-984559 GTGCACCAAAGGGACCAGGGAGG - Intronic
926126871 2:10277429-10277451 GTGGACCAGATGGAGGACGGGGG + Intergenic
926293783 2:11552557-11552579 GAGCTCCAGATGTACCTCCGCGG + Intronic
927946415 2:27137667-27137689 GTGCCCCAGCTGGACCACCAGGG + Exonic
936351415 2:111715506-111715528 GTGATGCAGATGAACCACAGTGG - Intergenic
936824290 2:116561991-116562013 GTGCTCCATATTGACCATGAAGG + Intergenic
939290062 2:140182426-140182448 GTGGTTCAGATGGGCCACTGTGG + Intergenic
948526947 2:238576683-238576705 GTGCTGTGGTTGGACCACGGAGG - Intergenic
948940711 2:241194941-241194963 GAGCTCCAGCTGGAACACGCTGG - Intronic
1170213389 20:13867881-13867903 GTGCTCCTGCTGGGCCACCGTGG + Intronic
1172381787 20:34499933-34499955 GTGCTCCAGAATGACCAATGGGG - Intronic
1174420801 20:50397907-50397929 TAGCTCCAAATGGACCATGGTGG - Intergenic
1178739278 21:35182677-35182699 GTCCCCCAGATGGAACACAGAGG - Intronic
952158082 3:30665596-30665618 GTGCTGCACATGGACAACTGTGG - Intronic
955426992 3:58801646-58801668 CTCCTCCAGACTGACCACGGTGG - Intronic
968757721 4:2425643-2425665 GGGCTCCAGCTGGACTACGCAGG - Intronic
969487425 4:7480102-7480124 GTGCTGCAGATGGGTCAGGGTGG + Intronic
985588602 5:753441-753463 GTGCTGGAGAGGGACCACGTGGG - Intronic
985603271 5:845880-845902 GTGCTGGAGAGGGACCACGTGGG - Intronic
985715644 5:1458288-1458310 GTGCAGCAGATGGATCACTGAGG - Intronic
986190933 5:5495285-5495307 GTGCCCCAGATCCTCCACGGCGG + Intergenic
986519917 5:8604379-8604401 GAAGTCCAGATGGACCATGGAGG - Intergenic
990168086 5:53017618-53017640 GGGCTCCAGAAGGAGCAGGGTGG + Intronic
991149052 5:63344734-63344756 GTGCTACAGATGAAAAACGGAGG + Intergenic
995106787 5:108383897-108383919 CTGCTCAAGATGGACTACGGTGG - Intergenic
998384676 5:141749936-141749958 GGGCTCCAGATAGACCGTGGTGG + Intergenic
1002579145 5:180197113-180197135 GTGCTGCAGAGGGACCAAGGAGG - Intronic
1002763040 6:216683-216705 GTGCTTCAGAATGACCAGGGAGG - Intergenic
1007464401 6:42041853-42041875 GGGCTCCAGATGGAGGAGGGAGG - Intronic
1011006621 6:82652817-82652839 GTCTTCCAGCTGGACCACAGTGG - Intergenic
1013824197 6:114191751-114191773 GTGGGCCAGGAGGACCACGGTGG - Intronic
1019592578 7:1843050-1843072 GTCCTCCAGATGGTCCCCAGAGG - Intronic
1021053761 7:16021298-16021320 GTGCTCCAGTTGTACAAGGGAGG + Intergenic
1022442527 7:30446037-30446059 GTACACCAGAAGGACCACTGGGG - Intronic
1031384285 7:121127990-121128012 GTGCTCCAGATTGACGTCAGAGG + Intronic
1044729678 8:95219921-95219943 GAGCTCCAGGTCGGCCACGGAGG + Intergenic
1047026396 8:120829153-120829175 GTGCTCCTGAGGGACCACCATGG + Intergenic
1049349085 8:142154482-142154504 CAGCTCCAGCTGGACCATGGAGG - Intergenic
1049853210 8:144845420-144845442 GTGGCCCAGGTGGAGCACGGTGG + Intronic
1050945545 9:11511942-11511964 GGGCTCCACATGGACTAGGGAGG - Intergenic
1053579116 9:39385074-39385096 GTGCTTAAGATGGCCCACAGAGG - Intergenic
1053843631 9:42213159-42213181 GTGCTTAAGATGGCCCACAGAGG - Intergenic
1054100699 9:60943879-60943901 GTGCTTAAGATGGCCCACAGAGG - Intergenic
1054122074 9:61219253-61219275 GTGCTTAAGATGGCCCACAGAGG - Intergenic
1054585648 9:66963006-66963028 GTGCTTAAGATGGCCCACAGAGG + Intergenic
1061743360 9:132723011-132723033 CAGCTCCAGATGGGCCACCGCGG + Intergenic
1061922457 9:133789495-133789517 GTGCTCAGGATGGACGAGGGAGG + Intronic
1185966210 X:4607035-4607057 GTGCTCCCGATGGACTCCTGCGG + Intergenic
1187432495 X:19237669-19237691 GTGCTCAAGCTGGGCCATGGTGG + Intergenic
1195702306 X:107714787-107714809 GTGCTGCAGAGGGGCCACGATGG - Intronic
1201280739 Y:12339933-12339955 GCCCACCAGCTGGACCACGGTGG - Intergenic
1202272066 Y:23082340-23082362 GTGTTCTAGAGGGACTACGGAGG - Intergenic
1202293960 Y:23338342-23338364 GTGTTCTAGAGGGACTACGGAGG + Intergenic
1202425063 Y:24716084-24716106 GTGTTCTAGAGGGACTACGGAGG - Intergenic
1202445726 Y:24954001-24954023 GTGTTCTAGAGGGACTACGGAGG + Intergenic