ID: 1135194911 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:20386413-20386435 |
| Sequence | GTGCTCCAGATGGACCACGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 99 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 93} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1135194911_1135194918 | 12 | Left | 1135194911 | 16:20386413-20386435 | CCCCCGTGGTCCATCTGGAGCAC | 0: 1 1: 0 2: 0 3: 5 4: 93 |
||
| Right | 1135194918 | 16:20386448-20386470 | CAAATGACCTCTGCTGCAGAGGG | No data | ||||
| 1135194911_1135194917 | 11 | Left | 1135194911 | 16:20386413-20386435 | CCCCCGTGGTCCATCTGGAGCAC | 0: 1 1: 0 2: 0 3: 5 4: 93 |
||
| Right | 1135194917 | 16:20386447-20386469 | GCAAATGACCTCTGCTGCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1135194911 | Original CRISPR | GTGCTCCAGATGGACCACGG GGG (reversed) | Intronic | ||