ID: 1135194916

View in Genome Browser
Species Human (GRCh38)
Location 16:20386423-20386445
Sequence CTTTCTCCAAGTGCTCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135194916_1135194918 2 Left 1135194916 16:20386423-20386445 CCATCTGGAGCACTTGGAGAAAG No data
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data
1135194916_1135194917 1 Left 1135194916 16:20386423-20386445 CCATCTGGAGCACTTGGAGAAAG No data
Right 1135194917 16:20386447-20386469 GCAAATGACCTCTGCTGCAGAGG No data
1135194916_1135194920 26 Left 1135194916 16:20386423-20386445 CCATCTGGAGCACTTGGAGAAAG No data
Right 1135194920 16:20386472-20386494 AAGTTCCAAGTCCAACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135194916 Original CRISPR CTTTCTCCAAGTGCTCCAGA TGG (reversed) Intronic