ID: 1135194918

View in Genome Browser
Species Human (GRCh38)
Location 16:20386448-20386470
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135194910_1135194918 15 Left 1135194910 16:20386410-20386432 CCACCCCCGTGGTCCATCTGGAG No data
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data
1135194916_1135194918 2 Left 1135194916 16:20386423-20386445 CCATCTGGAGCACTTGGAGAAAG No data
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data
1135194907_1135194918 19 Left 1135194907 16:20386406-20386428 CCGCCCACCCCCGTGGTCCATCT No data
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data
1135194911_1135194918 12 Left 1135194911 16:20386413-20386435 CCCCCGTGGTCCATCTGGAGCAC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data
1135194909_1135194918 16 Left 1135194909 16:20386409-20386431 CCCACCCCCGTGGTCCATCTGGA No data
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data
1135194912_1135194918 11 Left 1135194912 16:20386414-20386436 CCCCGTGGTCCATCTGGAGCACT No data
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data
1135194914_1135194918 9 Left 1135194914 16:20386416-20386438 CCGTGGTCCATCTGGAGCACTTG No data
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data
1135194913_1135194918 10 Left 1135194913 16:20386415-20386437 CCCGTGGTCCATCTGGAGCACTT No data
Right 1135194918 16:20386448-20386470 CAAATGACCTCTGCTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type