ID: 1135194920

View in Genome Browser
Species Human (GRCh38)
Location 16:20386472-20386494
Sequence AAGTTCCAAGTCCAACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135194919_1135194920 -6 Left 1135194919 16:20386455-20386477 CCTCTGCTGCAGAGGGCAAGTTC No data
Right 1135194920 16:20386472-20386494 AAGTTCCAAGTCCAACAGAGAGG No data
1135194916_1135194920 26 Left 1135194916 16:20386423-20386445 CCATCTGGAGCACTTGGAGAAAG No data
Right 1135194920 16:20386472-20386494 AAGTTCCAAGTCCAACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135194920 Original CRISPR AAGTTCCAAGTCCAACAGAG AGG Intronic
No off target data available for this crispr