ID: 1135196286

View in Genome Browser
Species Human (GRCh38)
Location 16:20397786-20397808
Sequence TAAGGTTCCAGGGAAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135196286_1135196300 25 Left 1135196286 16:20397786-20397808 CCCTGCTCTTCCCTGGAACCTTA No data
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data
1135196286_1135196292 -4 Left 1135196286 16:20397786-20397808 CCCTGCTCTTCCCTGGAACCTTA No data
Right 1135196292 16:20397805-20397827 CTTAGGCTCTGCCTAGCCTCTGG No data
1135196286_1135196293 -3 Left 1135196286 16:20397786-20397808 CCCTGCTCTTCCCTGGAACCTTA No data
Right 1135196293 16:20397806-20397828 TTAGGCTCTGCCTAGCCTCTGGG No data
1135196286_1135196294 4 Left 1135196286 16:20397786-20397808 CCCTGCTCTTCCCTGGAACCTTA No data
Right 1135196294 16:20397813-20397835 CTGCCTAGCCTCTGGGAACCTGG No data
1135196286_1135196298 15 Left 1135196286 16:20397786-20397808 CCCTGCTCTTCCCTGGAACCTTA No data
Right 1135196298 16:20397824-20397846 CTGGGAACCTGGTGCTGGTCAGG No data
1135196286_1135196296 10 Left 1135196286 16:20397786-20397808 CCCTGCTCTTCCCTGGAACCTTA No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135196286 Original CRISPR TAAGGTTCCAGGGAAGAGCA GGG (reversed) Intronic
No off target data available for this crispr