ID: 1135196287

View in Genome Browser
Species Human (GRCh38)
Location 16:20397787-20397809
Sequence CTAAGGTTCCAGGGAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135196287_1135196292 -5 Left 1135196287 16:20397787-20397809 CCTGCTCTTCCCTGGAACCTTAG 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1135196292 16:20397805-20397827 CTTAGGCTCTGCCTAGCCTCTGG No data
1135196287_1135196293 -4 Left 1135196287 16:20397787-20397809 CCTGCTCTTCCCTGGAACCTTAG 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1135196293 16:20397806-20397828 TTAGGCTCTGCCTAGCCTCTGGG No data
1135196287_1135196296 9 Left 1135196287 16:20397787-20397809 CCTGCTCTTCCCTGGAACCTTAG 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196287_1135196294 3 Left 1135196287 16:20397787-20397809 CCTGCTCTTCCCTGGAACCTTAG 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1135196294 16:20397813-20397835 CTGCCTAGCCTCTGGGAACCTGG No data
1135196287_1135196298 14 Left 1135196287 16:20397787-20397809 CCTGCTCTTCCCTGGAACCTTAG 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1135196298 16:20397824-20397846 CTGGGAACCTGGTGCTGGTCAGG No data
1135196287_1135196300 24 Left 1135196287 16:20397787-20397809 CCTGCTCTTCCCTGGAACCTTAG 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135196287 Original CRISPR CTAAGGTTCCAGGGAAGAGC AGG (reversed) Intronic
900636810 1:3669983-3670005 CCAAGGCTTCAGGGAGGAGCTGG - Intronic
900766805 1:4511439-4511461 CTAGGGGTGCAGAGAAGAGCAGG - Intergenic
901893301 1:12286736-12286758 CTAAGATTCGTGGGAAGAGCTGG + Intronic
902679358 1:18032081-18032103 TTAAGGATCCAGGGAACAGAGGG + Intergenic
902802093 1:18836923-18836945 ATATGGTTCCAGGGAAGATGAGG - Intergenic
905036727 1:34923522-34923544 CTAAGGGGCCAGGGAAAAGGGGG + Intronic
906124846 1:43421459-43421481 CTAAGGCCCCGGGGAAGAGGAGG + Intronic
907000750 1:50852232-50852254 ATAAGGTTTGAGGAAAGAGCGGG - Intronic
907425616 1:54377456-54377478 CTGAGGTTGCAGAAAAGAGCAGG + Intronic
907644468 1:56228108-56228130 GAAAGGTCCCAGGAAAGAGCAGG - Intergenic
910207952 1:84766314-84766336 CTAAGGTTAATGGAAAGAGCAGG + Intergenic
910366925 1:86475825-86475847 ATAAGGCTGCAGAGAAGAGCAGG + Intronic
911263454 1:95715251-95715273 CTACAGTTCCAGGCAGGAGCAGG - Intergenic
911664032 1:100534226-100534248 CTAAATTTGCAGGGCAGAGCAGG - Intergenic
913050447 1:115112892-115112914 TAAAGGTTCCAGGGAAAAGGTGG - Intergenic
914997314 1:152556068-152556090 CTAAAGGTACAGAGAAGAGCTGG + Intronic
915972436 1:160364146-160364168 CTAAGGTTCCACGGGAGAGGAGG - Intergenic
918125426 1:181579549-181579571 CTAAGCCTCCAGGGAGTAGCTGG - Intronic
919726747 1:200889479-200889501 CTGGAGATCCAGGGAAGAGCTGG - Intergenic
923336684 1:232977125-232977147 CCAAGGTTCCCGGTAAGAGCAGG - Intronic
1063665678 10:8058849-8058871 AAAAGGCTCCAGGGAAGAGCTGG - Intronic
1064562414 10:16606057-16606079 CTAAGGCTAAAGGGAAGACCAGG + Intronic
1066057882 10:31698365-31698387 ATAAGAGTCCAGGAAAGAGCTGG - Intergenic
1069893324 10:71665462-71665484 CTGAGGTCGCAGGGAAGAGAAGG + Intronic
1070471616 10:76785985-76786007 AATAGGTTCCAGGGAATAGCAGG - Intergenic
1073623361 10:105072070-105072092 CTGAGATTCCTGGGAAGTGCTGG + Intronic
1074565070 10:114570183-114570205 CTAATGTCCCAGGAAAGAGATGG + Intronic
1075569553 10:123529730-123529752 CTGAGGTCCCACAGAAGAGCTGG - Intergenic
1075884254 10:125883870-125883892 CTGAGTCCCCAGGGAAGAGCAGG - Intronic
1076458946 10:130625416-130625438 CACAGGTCCCAGGGAAAAGCGGG + Intergenic
1077887479 11:6396264-6396286 CTAGAGGTCCAGGGTAGAGCTGG - Intronic
1079983263 11:27174375-27174397 CCAAGGCTACTGGGAAGAGCTGG + Intergenic
1080772686 11:35356472-35356494 CCAGGGTTCCAGGGGAGTGCTGG - Intronic
1080863060 11:36167220-36167242 CTGAGGTTCCCGGGAAAAGAAGG - Intronic
1083585200 11:63852354-63852376 CAAAGGTTCCAGGAAAATGCTGG - Intronic
1084386173 11:68843909-68843931 CTGAGGTTCCAGGGAAAGGAGGG - Intronic
1084742300 11:71147534-71147556 CTCAAGCTCCAGGGAGGAGCAGG - Intronic
1086527962 11:87751254-87751276 CTAAGGTCCAAGGGATGACCTGG + Intergenic
1086890946 11:92257593-92257615 CAAAGGTTCCAGAGAAGGCCAGG - Intergenic
1088413803 11:109567351-109567373 TTAGGTTTCCAGGGACGAGCAGG + Intergenic
1089650580 11:119910266-119910288 GTCTGGTTCCAGGGAACAGCAGG + Intergenic
1090185853 11:124738749-124738771 CTAAGGTCCCAGAGAAGGGAAGG - Intergenic
1090500119 11:127252887-127252909 CTAAGGTACCAGGGGATACCTGG - Intergenic
1091160418 11:133414723-133414745 CTGATGTGGCAGGGAAGAGCTGG - Intronic
1091936343 12:4437386-4437408 GTAAGCTTGCATGGAAGAGCAGG + Intronic
1093744976 12:22729937-22729959 CTGAGTGTCCAGGGTAGAGCTGG - Intergenic
1094053190 12:26242851-26242873 CTCAGGTTCCATATAAGAGCTGG + Intronic
1095915506 12:47474426-47474448 CCCAGGTGCCAGGGAAGAGAAGG + Intergenic
1096800080 12:54104705-54104727 CTAAGGATCCAGAGATGATCAGG - Intergenic
1096813069 12:54183859-54183881 CCAAGCTTCCAGGGCAGGGCTGG + Exonic
1098364580 12:69689156-69689178 CCAAGGTTTCTGGGAAGAACAGG - Intronic
1099499008 12:83388534-83388556 CTAAAGTTCCATGTTAGAGCTGG - Intergenic
1101191477 12:102337892-102337914 CTGAGGTTTGAGAGAAGAGCAGG - Intergenic
1102627562 12:114247587-114247609 CCAAGGTTCCAGGAAAGATCAGG - Intergenic
1107742240 13:43463469-43463491 TTAAAGTGCCTGGGAAGAGCTGG + Intronic
1108680523 13:52776337-52776359 CAAAGGTTCCTGTGCAGAGCGGG - Intergenic
1108696177 13:52904470-52904492 CTAAGCCTCCAGGGTTGAGCTGG - Intergenic
1109781249 13:67113024-67113046 CTAAAGTTACAGGGAAAAGGAGG - Intronic
1113375732 13:109764175-109764197 CTAGGCTCCCAGGGAAGAGCAGG - Intronic
1114444793 14:22780178-22780200 CGAGGGTTCCAGTGCAGAGCAGG - Intronic
1115785153 14:36817324-36817346 CAAGGGTTTCAGGGAAGAGAAGG + Intronic
1116862299 14:50004268-50004290 CTAGGGTTACAGGCATGAGCCGG - Intronic
1117892163 14:60436527-60436549 CTTAGGTTCCAAGGAGAAGCAGG + Exonic
1120282294 14:82454661-82454683 CTAAGGTTCCTGGCACCAGCTGG - Intergenic
1120502516 14:85314065-85314087 CTAAGTTGACAAGGAAGAGCTGG - Intergenic
1121511570 14:94516617-94516639 CTGTGGTTCCAGGTAAGAGTTGG - Intronic
1122090550 14:99335710-99335732 ATAAGGTCCCTAGGAAGAGCGGG + Intergenic
1122817701 14:104321662-104321684 CTAATGTTCCATGAAAGGGCAGG + Intergenic
1123508211 15:20967474-20967496 CTAAGGCTGGAGGGAAGAGGTGG + Intergenic
1123565431 15:21541221-21541243 CTAAGGCTGGAGGGAAGAGGCGG + Intergenic
1123601695 15:21978510-21978532 CTAAGGCTGGAGGGAAGAGGCGG + Intergenic
1124173380 15:27398098-27398120 CTAAAATTTCAGAGAAGAGCCGG - Intronic
1124412956 15:29451753-29451775 CTAAGGTCACTGGGATGAGCAGG - Intronic
1128332895 15:66767480-66767502 CCAAGCTGCCAGGAAAGAGCTGG - Intronic
1129111145 15:73338023-73338045 CTGAGCTGCCTGGGAAGAGCTGG + Intronic
1129743217 15:78000276-78000298 CTGCGGTGCCAGGGAAGGGCGGG + Intronic
1129959494 15:79670439-79670461 CTAAAGTTCAAGGGAAAAGAGGG - Intergenic
1130060454 15:80566194-80566216 CTAGGGCTGCAGGCAAGAGCTGG - Intronic
1130607547 15:85331480-85331502 CTAAGTTACCAAGGGAGAGCTGG + Intergenic
1130917882 15:88320056-88320078 CTCAGGCTCCAGGGAACAGAAGG + Intergenic
1131537130 15:93246737-93246759 GTAAGGTTCCAGGAGAGTGCAGG + Intergenic
1131645573 15:94338616-94338638 CAAAGCTCCCAGGGAGGAGCCGG + Intronic
1202973803 15_KI270727v1_random:268311-268333 CTAAGGCTGGAGGGAAGAGGCGG + Intergenic
1133227808 16:4350905-4350927 GTAAGGTTCCAGGGCAGGGGAGG + Intronic
1133277097 16:4645677-4645699 CTGGAGCTCCAGGGAAGAGCTGG + Intronic
1135196287 16:20397787-20397809 CTAAGGTTCCAGGGAAGAGCAGG - Intronic
1137592011 16:49699504-49699526 ATGTGGTTCCAGGGAAGAACGGG - Intronic
1137669477 16:50271089-50271111 CCAGGCTTCCAGGGGAGAGCAGG - Intronic
1138159048 16:54736192-54736214 CTAAGGTTCCAGAGAATGGCTGG + Intergenic
1140454529 16:75097305-75097327 CTAAGCTTCCAGTCAAAAGCGGG - Intronic
1141804678 16:86334869-86334891 CTCAGGGTCCCTGGAAGAGCTGG - Intergenic
1143059682 17:4189545-4189567 ATAGGGTGGCAGGGAAGAGCAGG - Intronic
1143259262 17:5585944-5585966 TTAGGGTTTCAGTGAAGAGCTGG + Intronic
1144423379 17:15118157-15118179 CTAATGAACCAGGGAAGAGAAGG - Intergenic
1144463950 17:15481568-15481590 CTGTGGTTCTAGGGAAGACCTGG - Intronic
1145965752 17:28915744-28915766 CTAATGTTCCAGGAGAGAGCTGG + Intronic
1150590870 17:66560976-66560998 GAAAGGTTCCAGGGAAAAACTGG - Intronic
1152812645 17:82389314-82389336 AGAAGGTTCCAGGGAGGAACTGG - Intronic
1153797324 18:8636157-8636179 CTCAGCTTCAAGGGAAGGGCTGG - Intronic
1154022989 18:10681789-10681811 CTCAGGATGCAGAGAAGAGCTGG - Intronic
1154142793 18:11840523-11840545 CTATGTTTCAAAGGAAGAGCTGG - Intronic
1156775824 18:40787434-40787456 TTGAGGTTTCAGGGAAGAGAAGG - Intergenic
1157569687 18:48704166-48704188 CTACGGTACCAGGGCAGAGATGG - Intronic
1158064239 18:53386569-53386591 CTAAGATGACAAGGAAGAGCTGG + Intronic
1163447099 19:17353164-17353186 CTCGGGCCCCAGGGAAGAGCCGG - Intronic
1163688297 19:18724818-18724840 CTCAGGTTCCAGGGATGAGGAGG + Intronic
1164802624 19:31090303-31090325 ATGAGGTTCCAGGGAAGGGTAGG - Intergenic
1164941128 19:32252917-32252939 CTCAGCTCCCAGGGGAGAGCAGG + Intergenic
1165570468 19:36771321-36771343 CTAAGGTCCCAGGGCCAAGCTGG - Intronic
1167679788 19:50912290-50912312 CTGAGATCCCAGGGAAGAGGAGG + Intergenic
1167700950 19:51045247-51045269 CTAACCAGCCAGGGAAGAGCTGG + Intergenic
925290075 2:2741626-2741648 CTAAGGTTCAAGGTGAGTGCAGG + Intergenic
925513988 2:4659092-4659114 CGAGGTTTCCAGGGGAGAGCAGG - Intergenic
928056717 2:28063726-28063748 CAAAGATTCCAAAGAAGAGCTGG - Intronic
928281735 2:29952482-29952504 CTGAGATTCCAGGCAAGACCGGG - Intergenic
931262913 2:60635936-60635958 ATCAGGTCCCAGGGAAGGGCAGG - Intergenic
931731955 2:65161067-65161089 GTAATGATCCAGGCAAGAGCTGG + Intergenic
932798579 2:74719192-74719214 TGAAGGATCCAGGGAAGATCAGG + Intergenic
936050039 2:109215773-109215795 CTAAGGATGGAGGGATGAGCTGG + Intronic
936233213 2:110722402-110722424 CTAAGGTTCCAGGAAGGACATGG - Intergenic
936284805 2:111173663-111173685 CTAGGGTGCCAGTGGAGAGCAGG + Intergenic
938615501 2:132993574-132993596 CTGAGAGTACAGGGAAGAGCTGG - Intronic
939241114 2:139560759-139560781 CTAAGGGAACAGGGAACAGCAGG + Intergenic
944130261 2:196340023-196340045 TTAAAGTTCCAGGGAAAACCTGG - Intronic
948225424 2:236306041-236306063 CTAGGATTGCAGGGCAGAGCAGG - Intergenic
948256563 2:236572860-236572882 CTAAGGACCCTGGGAAGAGGTGG + Intronic
948375903 2:237520054-237520076 CTCAGGTTCCTGGGAGGGGCAGG - Intronic
1169428472 20:5514223-5514245 CTAGGGAGCCAGGGTAGAGCTGG + Intergenic
1169501284 20:6163135-6163157 CTCAGTTTCCTGGGAAGAGTTGG + Intergenic
1170989602 20:21289740-21289762 CAAAGGTTCCAGTGAATGGCAGG - Intergenic
1171796369 20:29569637-29569659 CTAAGGATCCAGAGATGATCAGG + Intergenic
1172808960 20:37633465-37633487 AGAGGGTTCCAGGGAAGAGCAGG + Intergenic
1173176369 20:40767786-40767808 CTGAGGTTCCAGGGATGACCAGG - Intergenic
1173178848 20:40786443-40786465 CTCAGACTCCAGGGATGAGCAGG + Intergenic
1174874261 20:54209897-54209919 CGTATGTTCCAGGGCAGAGCAGG + Intronic
1175410291 20:58763243-58763265 CTCAGGCTCCAGGGAGGGGCCGG - Intergenic
1175495490 20:59411392-59411414 ATAAGGGTCCCGGGAACAGCTGG + Intergenic
1176071530 20:63229226-63229248 CTGAGGTTTCAGGGAAGGGGTGG - Intergenic
1179412979 21:41176340-41176362 CGATGGTTCCTGGAAAGAGCAGG + Intronic
1181176878 22:21043005-21043027 CTGAAGATCCAGGGGAGAGCTGG + Intergenic
1182561334 22:31161711-31161733 ATTATGTTCCAGGGAAGAGAAGG - Intronic
1183688070 22:39373595-39373617 CTCAGGTACCAGGGAAGATGAGG - Intronic
1184813782 22:46855150-46855172 CTGAGGTTGCTGGGAAGTGCTGG + Intronic
1184991874 22:48175882-48175904 CAAAGGAGCCTGGGAAGAGCAGG - Intergenic
1185358075 22:50386983-50387005 GTAAGGTACCGCGGAAGAGCAGG - Intronic
949795906 3:7850832-7850854 GCAAGGTGCTAGGGAAGAGCTGG - Intergenic
954004447 3:47579669-47579691 CTCAGGTTCCTGGGTAGACCAGG + Exonic
955320327 3:57969908-57969930 CTAACTTTCCAGTGAATAGCTGG - Intergenic
956473653 3:69595855-69595877 CCATGGCTCCAGGGAAGACCTGG + Intergenic
957126719 3:76171104-76171126 TCAAGGTTCCTGGGAAGAGAGGG - Intronic
961716799 3:128863405-128863427 CTGAGGCTCCAGGGCTGAGCAGG - Intergenic
962103711 3:132369317-132369339 CTCAGGTCCCAGAGAATAGCTGG + Intergenic
965078237 3:164004375-164004397 CTGAGGGCCCAGGGAAAAGCCGG + Intergenic
968082571 3:195856877-195856899 CTGAGGTTCCAAGGGAGAGAGGG + Intergenic
968443941 4:638981-639003 CCAGGGTCCCAGGGAAAAGCTGG + Intronic
968664784 4:1815166-1815188 CTCAGGTTCCAGGGTAGCCCCGG - Intronic
969405463 4:6988476-6988498 CTGAGGACCCAGGGAAGCGCTGG - Intronic
972299597 4:37772377-37772399 CTGGGGATCCAGGCAAGAGCTGG - Intergenic
976216233 4:82718145-82718167 CCAAGGTTTCACAGAAGAGCTGG + Intronic
977175092 4:93809938-93809960 CAAAGGATCCAGCAAAGAGCAGG + Intergenic
978460624 4:108947560-108947582 CTTAGGTTTAAGGGATGAGCAGG + Intronic
980511650 4:133798031-133798053 CAAAGGTTGAAGGGAAGAACGGG - Intergenic
981819136 4:148866295-148866317 CTTAGGTTGCAGGGATTAGCAGG + Intergenic
984395390 4:179191589-179191611 CTAGGGTTGAAGGGAAGAGAAGG - Intergenic
985506110 5:281405-281427 CTGGAGGTCCAGGGAAGAGCTGG + Intronic
986543664 5:8872862-8872884 CTGAGGGGCCAGGGAGGAGCTGG - Intergenic
991632610 5:68671478-68671500 CTCAGGTTACCGGGCAGAGCTGG - Intergenic
991994382 5:72372762-72372784 CCAAGGTTTCAGGCAAGAGAAGG + Intergenic
998482340 5:142473400-142473422 CTAAGGTTACAAGGATGAGGAGG - Intergenic
999367495 5:151032730-151032752 GTAATGGTCCAGGGGAGAGCTGG + Intronic
1000636496 5:163649837-163649859 CAAGGGTCCCAGAGAAGAGCTGG + Intergenic
1000928497 5:167223246-167223268 CTAATGATCCAAGGAAGAGTAGG - Intergenic
1001878745 5:175223856-175223878 CTAAGAGTCCAGGGAAGATTTGG - Intergenic
1002329088 5:178429221-178429243 CCAAGGTCACAGGGCAGAGCTGG + Intronic
1003006282 6:2385047-2385069 TAAAGGTTCCAGGGAACAGCTGG - Intergenic
1003172539 6:3731540-3731562 GTCAGTTTCCATGGAAGAGCAGG - Intronic
1003968074 6:11272294-11272316 CTAATGTTCCATAGAAGAGAGGG + Intronic
1004478620 6:15998107-15998129 AAAAGGCTCCAGGAAAGAGCTGG + Intergenic
1006174133 6:32111682-32111704 CTGAGGTTACAGAGAACAGCCGG - Intronic
1006702356 6:35985779-35985801 CTAAGGTGCCAGAGATGGGCTGG + Intronic
1006747120 6:36350845-36350867 GTAGGGCTCCAGGGATGAGCCGG - Intergenic
1006850705 6:37096211-37096233 CTAACCAGCCAGGGAAGAGCTGG + Intergenic
1008381096 6:50840581-50840603 CTTCGGATCCAGGGAAGAGCTGG - Intronic
1008464065 6:51810668-51810690 CCAAGGTTCCAGGGCACATCAGG - Intronic
1010054764 6:71552054-71552076 CTGAGGGCCCAGGGAGGAGCCGG + Intergenic
1010572691 6:77496856-77496878 CTGAGGTTCCAGGAAAGAATAGG + Intergenic
1012386094 6:98685016-98685038 CTGAAGACCCAGGGAAGAGCTGG - Intergenic
1017408651 6:154146804-154146826 GTCAGGTTCCAGAGAAGAGTTGG + Intronic
1018441925 6:163821457-163821479 CTGAGGTTTCAGGGAAGCACTGG - Intergenic
1021585975 7:22208821-22208843 CAAAGATTCTAGGGAAGAACTGG + Intronic
1021761056 7:23903554-23903576 AGAAGATCCCAGGGAAGAGCTGG + Intergenic
1022609996 7:31861432-31861454 CTAGAGTTCCAGGGGAGATCAGG - Intronic
1023479747 7:40621436-40621458 CAAAGTCTCCAGGGAAGAGTGGG + Intronic
1024346777 7:48321810-48321832 CCAAGGTTCCAGGTAAGATGTGG + Intronic
1030349094 7:108463541-108463563 CACAGGGTCCAGGGTAGAGCAGG - Intergenic
1033449081 7:141447093-141447115 CCTAGGATACAGGGAAGAGCAGG + Intronic
1033517067 7:142117340-142117362 CTAAGGTTACAGGGAGGTGGTGG + Intronic
1034590364 7:152133215-152133237 CTATGGTTTCCTGGAAGAGCTGG + Intergenic
1035774910 8:2180779-2180801 CTTGCTTTCCAGGGAAGAGCTGG + Intergenic
1038348038 8:26750140-26750162 CTGAGGTTCCAGCGAGGAGACGG - Intronic
1039206547 8:35161927-35161949 CTATGGTTCCAGGCAGGAGCTGG - Intergenic
1039984577 8:42436728-42436750 CTGGGCTTCCAGGGAAGGGCTGG - Intronic
1040106149 8:43543200-43543222 CTAAGGGTACAGCCAAGAGCAGG - Intergenic
1040918380 8:52587445-52587467 CTAAGGTTCCAGGGGAGCCTGGG - Intergenic
1041058234 8:54009743-54009765 CTAAGGTTCCACAGCAGAGTAGG + Intronic
1041797456 8:61760429-61760451 AGAGGGTTCCAGGGAGGAGCTGG - Intergenic
1041896150 8:62926677-62926699 CTAAGGGTGCAGGGCAGAGGAGG - Intronic
1042323665 8:67505058-67505080 CTAAATTTCCAAGGAAGAGAAGG - Intronic
1042738288 8:72013193-72013215 CTAAGTTTCCAGGTCAAAGCAGG - Intronic
1044173226 8:89082826-89082848 CTAAGATTCCAGGGAGGAAGGGG - Intergenic
1045436805 8:102172190-102172212 CTAATATGCCAAGGAAGAGCAGG - Intergenic
1045493125 8:102685635-102685657 CTAAAGGTCCAGGGCATAGCTGG + Intergenic
1045670915 8:104552584-104552606 TTAAGGTTCCATGAAAGAGTAGG - Intronic
1048567921 8:135622993-135623015 CTGAGGTTCCGGGGAAGGTCTGG - Intronic
1048919131 8:139211824-139211846 CTCAAGGTCCAGGGAAGAGTGGG + Intergenic
1049812303 8:144580929-144580951 CTCGGGCTCCAGGGAGGAGCTGG + Exonic
1049970805 9:820437-820459 CTAGGGTTCAAGGGGAGGGCAGG + Intergenic
1050624525 9:7488719-7488741 CTTAGGGTCCAGGAAAGAACAGG - Intergenic
1053301096 9:36950128-36950150 CAAGGGTTCCTGGCAAGAGCCGG - Intronic
1053789653 9:41677785-41677807 CTAAGGATCCAGAGATGATCAGG - Intergenic
1054155491 9:61636968-61636990 CTAAGGATCCAGAGATGATCAGG + Intergenic
1054177991 9:61889476-61889498 CTAAGGATCCAGAGATGATCAGG - Intergenic
1054475276 9:65568078-65568100 CTAAGGATCCAGAGATGATCAGG + Intergenic
1054659538 9:67691348-67691370 CTAAGGATCCAGAGATGATCAGG + Intergenic
1054802396 9:69363555-69363577 CTAAGCCTGCAGGGAAGAGTGGG + Intronic
1056254777 9:84787841-84787863 CTAACTTACCAGTGAAGAGCAGG + Intronic
1057415986 9:94862633-94862655 AGAAGGTTCCAGGGAGGCGCTGG - Intronic
1058669059 9:107345437-107345459 CTATGGTTGCAGGGGAGGGCTGG - Intergenic
1059398228 9:114052244-114052266 CCAAGTTTCAAGGGGAGAGCTGG - Exonic
1059436567 9:114280642-114280664 CTAAGGTTCAGAGAAAGAGCAGG + Intronic
1059466157 9:114470116-114470138 CACAGGTTCCAGGGAGGAGGAGG + Intronic
1061266954 9:129511683-129511705 CTCAGCTTCCAGGGAAGGGGAGG + Intergenic
1061674530 9:132208307-132208329 GTAAGATTCCAAAGAAGAGCAGG + Intronic
1062510442 9:136902412-136902434 CTCAGGGTCCAGTGCAGAGCTGG - Intronic
1189126641 X:38454553-38454575 CTTTGATTCCAGGAAAGAGCAGG + Intronic
1189381289 X:40504232-40504254 CTTAGTTTCAAGGGAAGAGGTGG - Intergenic
1192191234 X:68992437-68992459 CAAAGGCTCCAGGGAGGAGAGGG + Intergenic
1194575507 X:95609269-95609291 CTATAGTTCCAGGGAAGAGTTGG - Intergenic
1195959844 X:110374834-110374856 ATAAGGTTCAAGGGAAGGGGTGG + Intronic
1197725553 X:129774062-129774084 CCAGGGCTCCAGGGAAGAGGAGG - Intergenic
1198575741 X:138008559-138008581 CTATTGTCCCAGGGAAGAGAAGG + Intergenic
1199859015 X:151782902-151782924 CTAGGGTTTCTGGGAAGAGGAGG - Intergenic