ID: 1135196291

View in Genome Browser
Species Human (GRCh38)
Location 16:20397804-20397826
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135196291_1135196301 14 Left 1135196291 16:20397804-20397826 CCTTAGGCTCTGCCTAGCCTCTG No data
Right 1135196301 16:20397841-20397863 GTCAGGCACGTCCTGGAAGCAGG No data
1135196291_1135196302 21 Left 1135196291 16:20397804-20397826 CCTTAGGCTCTGCCTAGCCTCTG No data
Right 1135196302 16:20397848-20397870 ACGTCCTGGAAGCAGGCCTTAGG No data
1135196291_1135196300 7 Left 1135196291 16:20397804-20397826 CCTTAGGCTCTGCCTAGCCTCTG No data
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data
1135196291_1135196298 -3 Left 1135196291 16:20397804-20397826 CCTTAGGCTCTGCCTAGCCTCTG No data
Right 1135196298 16:20397824-20397846 CTGGGAACCTGGTGCTGGTCAGG No data
1135196291_1135196296 -8 Left 1135196291 16:20397804-20397826 CCTTAGGCTCTGCCTAGCCTCTG No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196291_1135196303 22 Left 1135196291 16:20397804-20397826 CCTTAGGCTCTGCCTAGCCTCTG No data
Right 1135196303 16:20397849-20397871 CGTCCTGGAAGCAGGCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135196291 Original CRISPR CAGAGGCTAGGCAGAGCCTA AGG (reversed) Intronic
No off target data available for this crispr