ID: 1135196296

View in Genome Browser
Species Human (GRCh38)
Location 16:20397819-20397841
Sequence AGCCTCTGGGAACCTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135196291_1135196296 -8 Left 1135196291 16:20397804-20397826 CCTTAGGCTCTGCCTAGCCTCTG No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196280_1135196296 23 Left 1135196280 16:20397773-20397795 CCTGCCTCCCCTGCCCTGCTCTT No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196290_1135196296 -1 Left 1135196290 16:20397797-20397819 CCTGGAACCTTAGGCTCTGCCTA No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196279_1135196296 24 Left 1135196279 16:20397772-20397794 CCCTGCCTCCCCTGCCCTGCTCT No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196285_1135196296 14 Left 1135196285 16:20397782-20397804 CCTGCCCTGCTCTTCCCTGGAAC No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196287_1135196296 9 Left 1135196287 16:20397787-20397809 CCTGCTCTTCCCTGGAACCTTAG 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196283_1135196296 16 Left 1135196283 16:20397780-20397802 CCCCTGCCCTGCTCTTCCCTGGA No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196281_1135196296 19 Left 1135196281 16:20397777-20397799 CCTCCCCTGCCCTGCTCTTCCCT No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196284_1135196296 15 Left 1135196284 16:20397781-20397803 CCCTGCCCTGCTCTTCCCTGGAA No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196286_1135196296 10 Left 1135196286 16:20397786-20397808 CCCTGCTCTTCCCTGGAACCTTA No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data
1135196289_1135196296 0 Left 1135196289 16:20397796-20397818 CCCTGGAACCTTAGGCTCTGCCT No data
Right 1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135196296 Original CRISPR AGCCTCTGGGAACCTGGTGC TGG Intronic
No off target data available for this crispr