ID: 1135196300

View in Genome Browser
Species Human (GRCh38)
Location 16:20397834-20397856
Sequence GGTGCTGGTCAGGCACGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135196286_1135196300 25 Left 1135196286 16:20397786-20397808 CCCTGCTCTTCCCTGGAACCTTA No data
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data
1135196291_1135196300 7 Left 1135196291 16:20397804-20397826 CCTTAGGCTCTGCCTAGCCTCTG No data
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data
1135196289_1135196300 15 Left 1135196289 16:20397796-20397818 CCCTGGAACCTTAGGCTCTGCCT No data
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data
1135196285_1135196300 29 Left 1135196285 16:20397782-20397804 CCTGCCCTGCTCTTCCCTGGAAC No data
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data
1135196287_1135196300 24 Left 1135196287 16:20397787-20397809 CCTGCTCTTCCCTGGAACCTTAG 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data
1135196295_1135196300 -5 Left 1135196295 16:20397816-20397838 CCTAGCCTCTGGGAACCTGGTGC No data
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data
1135196297_1135196300 -10 Left 1135196297 16:20397821-20397843 CCTCTGGGAACCTGGTGCTGGTC No data
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data
1135196290_1135196300 14 Left 1135196290 16:20397797-20397819 CCTGGAACCTTAGGCTCTGCCTA No data
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data
1135196284_1135196300 30 Left 1135196284 16:20397781-20397803 CCCTGCCCTGCTCTTCCCTGGAA No data
Right 1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135196300 Original CRISPR GGTGCTGGTCAGGCACGTCC TGG Intronic
No off target data available for this crispr