ID: 1135196301

View in Genome Browser
Species Human (GRCh38)
Location 16:20397841-20397863
Sequence GTCAGGCACGTCCTGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135196295_1135196301 2 Left 1135196295 16:20397816-20397838 CCTAGCCTCTGGGAACCTGGTGC No data
Right 1135196301 16:20397841-20397863 GTCAGGCACGTCCTGGAAGCAGG No data
1135196297_1135196301 -3 Left 1135196297 16:20397821-20397843 CCTCTGGGAACCTGGTGCTGGTC No data
Right 1135196301 16:20397841-20397863 GTCAGGCACGTCCTGGAAGCAGG No data
1135196290_1135196301 21 Left 1135196290 16:20397797-20397819 CCTGGAACCTTAGGCTCTGCCTA No data
Right 1135196301 16:20397841-20397863 GTCAGGCACGTCCTGGAAGCAGG No data
1135196289_1135196301 22 Left 1135196289 16:20397796-20397818 CCCTGGAACCTTAGGCTCTGCCT No data
Right 1135196301 16:20397841-20397863 GTCAGGCACGTCCTGGAAGCAGG No data
1135196291_1135196301 14 Left 1135196291 16:20397804-20397826 CCTTAGGCTCTGCCTAGCCTCTG No data
Right 1135196301 16:20397841-20397863 GTCAGGCACGTCCTGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135196301 Original CRISPR GTCAGGCACGTCCTGGAAGC AGG Intronic
No off target data available for this crispr