ID: 1135201797

View in Genome Browser
Species Human (GRCh38)
Location 16:20443959-20443981
Sequence CACATTGCACAATAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135201797_1135201803 20 Left 1135201797 16:20443959-20443981 CCAACCTCCTATTGTGCAATGTG No data
Right 1135201803 16:20444002-20444024 TTGGTTTTTTTCTTTTTAGAGGG No data
1135201797_1135201802 19 Left 1135201797 16:20443959-20443981 CCAACCTCCTATTGTGCAATGTG No data
Right 1135201802 16:20444001-20444023 TTTGGTTTTTTTCTTTTTAGAGG No data
1135201797_1135201801 1 Left 1135201797 16:20443959-20443981 CCAACCTCCTATTGTGCAATGTG No data
Right 1135201801 16:20443983-20444005 TAAATCACAGCAACAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135201797 Original CRISPR CACATTGCACAATAGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr