ID: 1135204476

View in Genome Browser
Species Human (GRCh38)
Location 16:20471378-20471400
Sequence ATGTCTATGTATAAGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135204476_1135204478 -4 Left 1135204476 16:20471378-20471400 CCTTCCTACTTATACATAGACAT 0: 1
1: 0
2: 3
3: 16
4: 158
Right 1135204478 16:20471397-20471419 ACATATGCCTATAAACCTGCAGG 0: 2
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135204476 Original CRISPR ATGTCTATGTATAAGTAGGA AGG (reversed) Intronic
906439720 1:45830720-45830742 AAGTATATGTATAAGAATGAGGG + Intronic
906768795 1:48463336-48463358 ATGTATGTGTATAGGTAGGGGGG + Intronic
907722251 1:56983014-56983036 ATGTCTATATATATATATGATGG - Intergenic
911618102 1:100037302-100037324 ATGTGTATGTATATGTAGGTGGG - Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
912231508 1:107798292-107798314 ATGCCTGTGTAAAAATAGGAGGG + Intronic
912276880 1:108268194-108268216 ATATATATGTTTAAGTAGAATGG + Intergenic
912291349 1:108426161-108426183 ATATATATGTTTAAGTAGAATGG - Intronic
912656763 1:111492944-111492966 ATTTAGATGTATAAATAGGAAGG + Intronic
918754378 1:188318770-188318792 CTGACTATGTCTAAGTAGGAAGG - Intergenic
921835198 1:219771541-219771563 AAGTCAATGTATGGGTAGGATGG - Intronic
923832380 1:237572165-237572187 ATGTCAAAGTATTAGTGGGAAGG + Intronic
1066228201 10:33405131-33405153 ATGGATATGTATAGCTAGGATGG + Intergenic
1068145090 10:53059172-53059194 ATGTTTATGCAAAAGAAGGAAGG - Intergenic
1068951108 10:62778564-62778586 ATGTATATGTGTATATAGGATGG + Intergenic
1069151386 10:64965383-64965405 ATGCCTATGTATGTGTAGGTAGG - Intergenic
1070863300 10:79690418-79690440 ATGTATATGTATTTGAAGGAGGG - Intergenic
1078621576 11:12913440-12913462 ATGTATATGTATACGTATAATGG - Intronic
1078974375 11:16454865-16454887 AGGTCTATAAATAAGTAGAAAGG - Intronic
1081073897 11:38643941-38643963 AAGGCTATGTCTATGTAGGATGG + Intergenic
1082869312 11:57929520-57929542 ATGTCTATTTTTAAAAAGGAAGG - Intergenic
1082952067 11:58828018-58828040 AAGTCCATATATCAGTAGGAAGG - Intergenic
1084913642 11:72411294-72411316 GCTTCTATGTATATGTAGGAGGG + Intronic
1088068175 11:105747513-105747535 ATGTCTATGTATTATTCAGATGG + Intronic
1088846261 11:113670793-113670815 ATGTCTATGTGTAAGTGTGCAGG - Intergenic
1090608461 11:128449330-128449352 ATGTGTATGTATCAGAGGGATGG - Intergenic
1092292331 12:7169071-7169093 AGGTGTAAGTATAAGTAGCAAGG - Intergenic
1092564488 12:9649742-9649764 CTGTCTCAGTATTAGTAGGAGGG + Intergenic
1094468238 12:30777772-30777794 AAGTCTATATATCAGTAGGCAGG - Intergenic
1096056379 12:48655901-48655923 ATGTATGTGTGTAAGTAGGTGGG - Intronic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1097887288 12:64741691-64741713 ATGTCTTTGTTTAAATGGGAGGG - Intronic
1097933260 12:65214401-65214423 ATATATATATATACGTAGGAAGG + Intronic
1098291029 12:68956795-68956817 ATGTCTATCCATAAGTAAAATGG - Intronic
1100510371 12:95265161-95265183 ATGTGTATATATAAGAAAGAGGG - Intronic
1100543598 12:95580636-95580658 GTGTCTATGTATATGTAGGTGGG + Intergenic
1102369345 12:112369081-112369103 ATGTCTATATATAGGCAGGAGGG - Intronic
1104119871 12:125789022-125789044 ATGTATATGTATAAGAAAAAGGG + Intergenic
1106610728 13:31277403-31277425 ATGTCTATTTATATTTAGGATGG - Intronic
1108008925 13:45983392-45983414 ATATATATATATAAGTAGAAGGG - Intronic
1108431080 13:50354399-50354421 AGGTCTATGTATGAGAAGAATGG - Intronic
1108540367 13:51438373-51438395 ATTTGTATGTATAGTTAGGAAGG - Intronic
1108550091 13:51535480-51535502 ATGTCTTTATAAAAGTAAGAGGG + Intergenic
1109944716 13:69418990-69419012 ATGTCTATTAACAAGGAGGATGG - Intergenic
1110484584 13:76023143-76023165 CTATCTATGTATATGTGGGAAGG + Intergenic
1110591454 13:77266907-77266929 GTATCTATGTATATGTAGTAAGG + Intronic
1110958587 13:81590588-81590610 ATGTATATGTATAAGCATTATGG + Intergenic
1111108620 13:83677275-83677297 ATGTGTATGTATATGTGTGATGG + Intergenic
1112026018 13:95411869-95411891 TTGTTTATTTATAAGTAGAAAGG + Intergenic
1112689619 13:101877165-101877187 ATCTCTCTGTATAAGCATGAGGG - Intronic
1112953079 13:105026531-105026553 ATGTATATTTATATGTGGGAAGG - Intergenic
1112983750 13:105420484-105420506 ATGTCAATGTGTAAGGATGATGG - Intergenic
1116619790 14:47185941-47185963 ATACCTATTTATAATTAGGATGG + Intronic
1116682334 14:47988405-47988427 ATGTATGTGTATAAATAGAAAGG + Intergenic
1117163258 14:53009538-53009560 TTGTCAATGTACATGTAGGACGG - Intergenic
1117279578 14:54225217-54225239 ATGTTTATGTGTATGTAGAAAGG + Intergenic
1119335898 14:73833549-73833571 CTGTGTTTTTATAAGTAGGAGGG + Intergenic
1122186458 14:100001118-100001140 AAGTCCATGTATCAGTAGGCAGG + Intronic
1202884460 14_KI270722v1_random:91366-91388 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1126306165 15:47260617-47260639 ATGTCTCTGTACAGGTTGGAGGG + Intronic
1134032854 16:11006421-11006443 ATGTCTATCTCAAAATAGGATGG - Intronic
1134105914 16:11485961-11485983 ATGTCCATGTATGGGTAGGAGGG + Intronic
1134379981 16:13715061-13715083 ATGTGTATGTTTGAGTAGGCTGG + Intergenic
1135204476 16:20471378-20471400 ATGTCTATGTATAAGTAGGAAGG - Intronic
1135214410 16:20552433-20552455 ATGTTTAAGTATAAGTAGGAAGG + Intronic
1137008610 16:35301443-35301465 GATTCTATGTACAAGTAGGATGG - Intergenic
1137366956 16:47868712-47868734 ATGTGTATGTGTAAGTAGGTAGG - Intergenic
1137451236 16:48576719-48576741 ATGACTTTGAAAAAGTAGGAAGG - Intronic
1140919246 16:79521566-79521588 TTGACTATGTAGAAGAAGGAGGG - Intergenic
1140925068 16:79574791-79574813 ATGTCAATGAAGAACTAGGAAGG + Intergenic
1144296984 17:13885641-13885663 CTGTCTTTGTATCATTAGGAGGG + Intergenic
1144304661 17:13957220-13957242 GTGTCTGTGTATAGGTTGGAGGG - Intergenic
1145869780 17:28264317-28264339 AAGTCTATGCATCAGTAGGCAGG + Intergenic
1157944418 18:51962800-51962822 ATGTGTATCTATACATAGGATGG + Intergenic
1160129766 18:76214411-76214433 AGCTCTATGTTTAAGTGGGATGG + Intergenic
1161581700 19:5084638-5084660 ATATGTATGTATAATTAAGATGG + Intronic
1163044799 19:14632851-14632873 GTGTGTATGGATATGTAGGAAGG + Intronic
1166010659 19:39939509-39939531 ACGCATATGTATAAGTGGGAGGG - Intergenic
1202633613 1_KI270706v1_random:22741-22763 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202652273 1_KI270707v1_random:17318-17340 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1202659868 1_KI270708v1_random:58412-58434 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
926769863 2:16361174-16361196 ATCTCTATGTTTAAGTTGAAAGG - Intergenic
927001711 2:18802146-18802168 ATGTCAAAGTATGAGTAGAAAGG - Intergenic
928884204 2:36129817-36129839 ATGTATATGTATAAATGTGATGG + Intergenic
930557071 2:52910728-52910750 ATGTCCATTAATAAGTAGAATGG + Intergenic
931789594 2:65652688-65652710 ATGTGTATGTATACGTAGTGGGG - Intergenic
931877667 2:66531373-66531395 AAGTCTCTGTTTAAATAGGAAGG + Intronic
932675371 2:73775990-73776012 ATGTCTACATATATGAAGGATGG + Intronic
932692563 2:73925802-73925824 ATGTTGATGTATATATAGGATGG - Intergenic
933562114 2:83900700-83900722 ATGTCTCTGTTTAAGTAGTCAGG - Intergenic
933598618 2:84307236-84307258 ATGACTATTCATAAGTAGGTGGG - Intergenic
934917141 2:98309402-98309424 ATGGCTATGTATGAGTCGGCAGG + Intronic
942379915 2:175378493-175378515 ATGTCTATATAAAAATGGGAAGG + Intergenic
942533885 2:176942404-176942426 ATATATATGTATATGCAGGAGGG + Intergenic
943396830 2:187348936-187348958 ATGACCATGTATAAGTAGTAAGG + Intronic
943890829 2:193284819-193284841 ATATATATGTATATGTATGATGG - Intergenic
946565668 2:220962026-220962048 ATGTCTATCTATATTGAGGAGGG - Intergenic
946687722 2:222288523-222288545 ATTTTTATGTAAAAGTAGGTAGG - Intronic
947557908 2:231113599-231113621 ATGTTAATGTATCAGTAGGCTGG + Intronic
1169553263 20:6723244-6723266 ATGCCTATTTATAAGCAGGAAGG - Intergenic
1169833362 20:9850586-9850608 ATGTATATGTATATGTATGTAGG - Intergenic
1176599878 21:8782337-8782359 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176645827 21:9348598-9348620 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180327343 22:11441974-11441996 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180367101 22:11950555-11950577 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1180378983 22:12120793-12120815 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1181900762 22:26153830-26153852 CTGTCTATATTTGAGTAGGATGG - Intergenic
1184802774 22:46772036-46772058 ATGTATATGTATATATACGATGG - Intronic
951169662 3:19526112-19526134 ATGTATATGTATTAGTAGTGGGG + Intronic
951381778 3:21993712-21993734 ATGTTTTTGTATTAGTAGGAAGG - Intronic
951598058 3:24339732-24339754 ATGGGTATGTTTAAGTTGGAAGG - Intronic
952522070 3:34171216-34171238 ATATCTGTGTATAAGCAGGTGGG - Intergenic
955456805 3:59130736-59130758 ATGTCTAAGCATAAATAAGATGG - Intergenic
958177417 3:90014116-90014138 ATGTCTTTGAAAAAGTAGGCTGG + Intergenic
958698570 3:97558132-97558154 ATGCCTATGTTTCAGTAGAAAGG - Intronic
959177001 3:102925732-102925754 ATGCCTTTGTAAATGTAGGAGGG + Intergenic
963472414 3:145757741-145757763 ATGTCTAAGGATAGGTAGGATGG + Intergenic
965906624 3:173715547-173715569 ATTTCTATGTATCAGGAGGAAGG + Intronic
967373313 3:188772912-188772934 CTATGTATGTATAAGAAGGAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
1202741058 3_GL000221v1_random:56465-56487 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
971133865 4:23845045-23845067 ACGTATAGGTATAAGCAGGAGGG + Intronic
972857665 4:43126748-43126770 TTCTCTATGTATAAGGAGAATGG + Intergenic
978346428 4:107774961-107774983 ATGTCTAAGCATTAGTAGAATGG - Intergenic
979925051 4:126551917-126551939 AAGTCTATTAATCAGTAGGATGG + Intergenic
983558361 4:169077976-169077998 ATGTCTACATATAATTAGGGTGG - Intergenic
1202760601 4_GL000008v2_random:106272-106294 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
989184638 5:38611539-38611561 ATGTTTAGGAATTAGTAGGAAGG + Intergenic
989377182 5:40776736-40776758 ATGTTCAGGTATAAGCAGGATGG + Intronic
993760639 5:91792562-91792584 ATGTTTATGTATGAGGAGAAGGG - Intergenic
993987474 5:94614410-94614432 ATCTGTGTGTATAACTAGGATGG - Intronic
994488775 5:100414727-100414749 ATGTGTTTGTATAAGTAGCATGG + Intergenic
994588892 5:101748690-101748712 ATGTGTGTGTGTAAGTAGGTAGG - Intergenic
994888401 5:105597326-105597348 ATGTATATGTATATGTATGATGG + Intergenic
997048029 5:130343394-130343416 ATGCCTATGTAAAAGTATAAAGG + Intergenic
1001355169 5:171014210-171014232 ATGTCTTTATATAAATAGGGTGG + Intronic
1001831694 5:174794386-174794408 ATGTCTTTGTAAAAGTAGGAGGG + Intergenic
1009832240 6:68953078-68953100 ATTTCTATGAAGAATTAGGAAGG - Intronic
1011755220 6:90491917-90491939 AAGTCTAAGTTTAAGGAGGAAGG - Intergenic
1012194004 6:96316856-96316878 ATGTGTATGTGTATGTAGCAAGG - Intergenic
1016610962 6:145989088-145989110 ATGACTATGAATAAGTGGGCAGG - Intergenic
1016633019 6:146254026-146254048 GTGTGTATGTATAAGTTTGAGGG + Intronic
1017572722 6:155764604-155764626 ATGTCTGGGTATAAGTTAGAGGG + Intergenic
1018735330 6:166683654-166683676 ATGTCTCTGGATAACTAGGTAGG + Intronic
1019878134 7:3834096-3834118 ATGTCTATGTAGAAGAACCAAGG + Intronic
1021148697 7:17121810-17121832 ATCTCTATGTTTAAATAGAATGG + Intergenic
1021415827 7:20383384-20383406 ATGACTAAGTAGAAGTAGGTGGG - Intronic
1024303421 7:47905348-47905370 ATGTCTATGTCAACATAGGAGGG + Intronic
1024707464 7:51976132-51976154 ATGTCTATTAATAAGAAGAAAGG + Intergenic
1024908517 7:54418323-54418345 ATTTCTATGTATAACAAAGAAGG - Intergenic
1026616929 7:71913478-71913500 CTCTCTATGTATAAGAAAGAAGG + Intronic
1027675882 7:81157941-81157963 ATGTGTATGTGTATGTTGGAGGG + Intergenic
1028607564 7:92671746-92671768 AACTCTATGTCTAACTAGGATGG + Intronic
1030519525 7:110580713-110580735 ATGTATATATATATATAGGAAGG + Intergenic
1031621761 7:123942036-123942058 AAGTCTATGAATCAGTAGGCTGG + Intronic
1034015607 7:147581893-147581915 ATTTATATGTATAAATAGGCAGG - Intronic
1037193311 8:16154254-16154276 AGGTCTAATTATAAGTAGAATGG - Intronic
1040503930 8:48029942-48029964 ATTTCTAAGTAAAATTAGGATGG - Intronic
1046202027 8:110939503-110939525 ATGACTTTGTTTAAGTGGGAAGG + Intergenic
1046572903 8:115989051-115989073 ATGTCTATGTACAGTTAGGGGGG - Intergenic
1047184872 8:122623883-122623905 ATGGCTATGTCTAATTAAGAAGG - Intergenic
1048532742 8:135265211-135265233 ATGTCAATGTATAATTAACAGGG - Intergenic
1052467008 9:28841216-28841238 ATGTATATGTACATGTGGGATGG + Intergenic
1055529826 9:77172888-77172910 AAGGTTAAGTATAAGTAGGATGG - Intergenic
1056037568 9:82623293-82623315 ATGTCTATGTAAGAGTAGTTTGG + Intergenic
1203709697 Un_KI270742v1:86395-86417 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1203541370 Un_KI270743v1:91158-91180 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1185933494 X:4229746-4229768 ATGTTTATTTATAAGTAGGTAGG - Intergenic
1185940404 X:4312397-4312419 ATGTCTATGTGTGGGTAGAAGGG - Intergenic
1186876064 X:13819396-13819418 TTCTATATGTAGAAGTAGGATGG + Intronic
1188933818 X:36148574-36148596 ATGTCTCTGGATCAGGAGGAAGG + Intergenic
1190445627 X:50520967-50520989 ATGGCCAGGTAGAAGTAGGAAGG + Intergenic
1192384668 X:70655079-70655101 TTTTGTATGTATAAGTAGTATGG + Intronic
1194142629 X:90223416-90223438 ATTTCTAGGTATGGGTAGGAGGG + Intergenic
1195433877 X:104819918-104819940 ATCTCTAAGTATAAATATGAGGG + Intronic
1197026232 X:121753172-121753194 ATGTCTATGAAAAAGCAGTATGG + Intergenic
1199888573 X:152049823-152049845 TTGTCAATTTATAAGCAGGATGG + Intergenic
1201725774 Y:17150264-17150286 ATGTCTAGGTGTAGGTAGAAGGG - Intergenic