ID: 1135205451

View in Genome Browser
Species Human (GRCh38)
Location 16:20480133-20480155
Sequence CAGGGTCCCAGGGGGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135205443_1135205451 6 Left 1135205443 16:20480104-20480126 CCAGCTATTGTAGAAATATGCAC No data
Right 1135205451 16:20480133-20480155 CAGGGTCCCAGGGGGCTTCCTGG No data
1135205441_1135205451 26 Left 1135205441 16:20480084-20480106 CCTCAGCTGAATAGACGGACCCA No data
Right 1135205451 16:20480133-20480155 CAGGGTCCCAGGGGGCTTCCTGG No data
1135205442_1135205451 7 Left 1135205442 16:20480103-20480125 CCCAGCTATTGTAGAAATATGCA No data
Right 1135205451 16:20480133-20480155 CAGGGTCCCAGGGGGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135205451 Original CRISPR CAGGGTCCCAGGGGGCTTCC TGG Intronic
No off target data available for this crispr