ID: 1135205518

View in Genome Browser
Species Human (GRCh38)
Location 16:20480648-20480670
Sequence GATGGGTATTTCCAGTTTAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135205514_1135205518 -4 Left 1135205514 16:20480629-20480651 CCGGGGAATCAAAGATGAAGATG 0: 2
1: 0
2: 2
3: 21
4: 300
Right 1135205518 16:20480648-20480670 GATGGGTATTTCCAGTTTATGGG 0: 2
1: 0
2: 1
3: 14
4: 156
1135205513_1135205518 5 Left 1135205513 16:20480620-20480642 CCTTGGAGACCGGGGAATCAAAG 0: 2
1: 0
2: 0
3: 4
4: 99
Right 1135205518 16:20480648-20480670 GATGGGTATTTCCAGTTTATGGG 0: 2
1: 0
2: 1
3: 14
4: 156
1135205507_1135205518 30 Left 1135205507 16:20480595-20480617 CCAACATTCGAGGAGACTTTTGG 0: 2
1: 0
2: 0
3: 4
4: 44
Right 1135205518 16:20480648-20480670 GATGGGTATTTCCAGTTTATGGG 0: 2
1: 0
2: 1
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135205518 Original CRISPR GATGGGTATTTCCAGTTTAT GGG Exonic
900976809 1:6022625-6022647 AATGGGAAGTTCCAGTTTAATGG - Intronic
902306654 1:15545501-15545523 GGTGGTTATTTCCAGTATGTTGG + Intronic
902657934 1:17882264-17882286 GATGAGAGTTTCTAGTTTATGGG + Intergenic
903413033 1:23162327-23162349 CATGGGTATATTCAGTTTGTGGG + Intronic
905164483 1:36070166-36070188 GATGGTTATTCCCTGTTTCTTGG + Exonic
906822624 1:48945266-48945288 GATAGTTATCTCCATTTTATAGG + Intronic
907914288 1:58854281-58854303 GGTGGGTATTCTCATTTTATAGG + Intergenic
909361381 1:74763095-74763117 GATGGGAATATTCAGTGTATAGG + Intronic
909425368 1:75518200-75518222 GATGGATATACCAAGTTTATTGG - Intronic
911357569 1:96841234-96841256 CATGGTTATTGCCAGATTATAGG + Intergenic
912720792 1:112018410-112018432 GATGGGCAGTTCCAGCTAATAGG + Intergenic
912732932 1:112125721-112125743 AATGGCTATTTCCATGTTATAGG - Intergenic
913498093 1:119446746-119446768 GGTGACTATTTCCATTTTATTGG + Intergenic
914044636 1:144080508-144080530 GTTGGGGACTTCCAGGTTATAGG - Intergenic
914133474 1:144880178-144880200 GTTGGGGACTTCCAGGTTATAGG + Intergenic
916226799 1:162497079-162497101 AATGGGTCCTTCCAGGTTATAGG + Intergenic
919377064 1:196808353-196808375 GATTGTTATTTCCAGTGAATAGG + Intergenic
919508023 1:198424659-198424681 GATAGGTATGACCAATTTATTGG + Intergenic
921537280 1:216367600-216367622 GAAGGATATTTTCACTTTATAGG + Intronic
923053914 1:230410877-230410899 GAGGGGTTTTTCTATTTTATTGG - Intronic
1066174973 10:32893793-32893815 GTTGCATATATCCAGTTTATTGG + Intergenic
1067266024 10:44745928-44745950 GGTGGGTGCTTCCAGCTTATGGG + Intergenic
1069611219 10:69773928-69773950 GATGGGAATTCCCTGTTTTTAGG - Intergenic
1074454487 10:113585659-113585681 GAAGGGTTTTTCCAGGATATGGG - Intronic
1077788314 11:5409768-5409790 GATGCGTTTTACCAGTTTAGGGG - Intronic
1078880778 11:15446818-15446840 GATGGCTCTTTCCACTTCATGGG + Intergenic
1080778542 11:35408841-35408863 TATGCATATTTCCAGTTTATGGG - Intronic
1081937937 11:46917906-46917928 GAGGGCTATTTACAATTTATGGG + Intronic
1082612685 11:55320819-55320841 GATGGGTCTAGCCAGTTTAAGGG + Intergenic
1084351037 11:68599571-68599593 TAAGGTTATTTCTAGTTTATTGG + Intronic
1085967483 11:81545685-81545707 GATAGGTGATTTCAGTTTATAGG - Intergenic
1087191140 11:95255832-95255854 GTTGTTTATTTCCAGTTTAAAGG - Intergenic
1087539206 11:99493405-99493427 CATGTGTATTTTCATTTTATAGG + Intronic
1089778003 11:120852518-120852540 GATGTGCATGTCCAGGTTATGGG + Intronic
1092308316 12:7324348-7324370 GATGGGTATTTCTGGTTTGTCGG + Exonic
1094183712 12:27618580-27618602 GTTGGTTAGTTCCAGATTATAGG - Intronic
1096857236 12:54492818-54492840 GAAGGGTTCCTCCAGTTTATGGG + Intergenic
1098642978 12:72860875-72860897 GATGGGTCTTTCCAAATTGTAGG + Intergenic
1100805588 12:98279879-98279901 TATTGTTATTTCCATTTTATGGG + Intergenic
1100917239 12:99438205-99438227 AATGGATATTTTCATTTTATAGG - Intronic
1101267702 12:103107395-103107417 GATGTGTATTTCGATTTTCTGGG - Intergenic
1102343383 12:112141364-112141386 GGAGGTTATTTCCATTTTATAGG - Intronic
1104671567 12:130684217-130684239 GATGGGGACTTCCAGGTGATAGG - Intronic
1109830451 13:67780068-67780090 GAGGGATATATCCAGTTTATTGG + Intergenic
1111079781 13:83289019-83289041 GATAGGTAGATGCAGTTTATGGG - Intergenic
1112449762 13:99498163-99498185 GATGGGGATTTACTGTTTAATGG - Intergenic
1112874459 13:104018414-104018436 GATGATTATTGCCATTTTATAGG + Intergenic
1113109207 13:106803810-106803832 GAAGGGAACTTGCAGTTTATTGG + Intergenic
1114797514 14:25733137-25733159 AATGGGTATCTCCAATTTATTGG - Intergenic
1116598657 14:46888874-46888896 GATTGATATATCCATTTTATAGG + Intronic
1118105800 14:62658012-62658034 CATGGGGACTTCCAGGTTATAGG - Intergenic
1122271782 14:100571532-100571554 GCTGTGCATTTGCAGTTTATAGG + Intronic
1125351158 15:38768955-38768977 GATTGATATTTTCAGTTTTTGGG - Intergenic
1127507259 15:59609493-59609515 GGGGGGTATTTCCAGGCTATAGG - Intronic
1128207786 15:65868567-65868589 GATGGTAATTTCCATTTTAGCGG - Intronic
1128961526 15:72011133-72011155 GCTGGGTAGTTCCAGTTGCTTGG - Intronic
1129655331 15:77520510-77520532 TTTGGGTATTTCCAGCTTTTTGG - Intergenic
1130123755 15:81074774-81074796 AGTGAGTATTTCCATTTTATAGG + Intronic
1131682284 15:94736702-94736724 GGTGGGACTTTCTAGTTTATTGG - Intergenic
1131895418 15:97022964-97022986 GCTGCTTATTTCCTGTTTATGGG - Intergenic
1133962233 16:10504596-10504618 GGTGGGAATTTCCAGGTCATAGG - Intergenic
1135205518 16:20480648-20480670 GATGGGTATTTCCAGTTTATGGG + Exonic
1135213389 16:20543165-20543187 GATGGGTATTTCCAGTTTATGGG - Exonic
1135233230 16:20729305-20729327 GATGGGTATTTCTGGTTTGTCGG + Intronic
1138131903 16:54487036-54487058 TATGGGTATTCCCATTTTACAGG + Intergenic
1141030586 16:80584414-80584436 GAGGGGTAGTTCCAGGTCATAGG - Intergenic
1141412030 16:83841759-83841781 GAAGGGTCTATCCAGTTGATCGG + Intergenic
1144086305 17:11811728-11811750 GATGCTTATTGCCAGATTATTGG - Intronic
1144094144 17:11884520-11884542 GATGCTTATTGCCAGATTATTGG + Intronic
1144122268 17:12166505-12166527 CATGGGTAACTCCAGTTGATAGG + Intergenic
1145005982 17:19338076-19338098 CATAGGTCTTTCTAGTTTATAGG - Intronic
1150346865 17:64411302-64411324 GATGGGTATATGCAGTGGATAGG + Intronic
1150887004 17:69098783-69098805 GATGGTTATTTCCAGGGGATGGG + Intronic
1152005335 17:77676881-77676903 GATGGGAATTTCCACTATCTGGG - Intergenic
1152130051 17:78471039-78471061 GATGTGTATTTCCAGCGTTTTGG + Intronic
1154388690 18:13918218-13918240 GATGGGTATGTTCAGTAGATTGG - Intergenic
1155707900 18:28838654-28838676 AATGGGTTTTTCCTTTTTATGGG + Intergenic
1158821409 18:61163336-61163358 GAGGGGGACTTCCAGATTATAGG - Intergenic
1160142371 18:76337130-76337152 AACGGGTATTTCCTGTGTATAGG + Intergenic
1164705349 19:30315276-30315298 GATGGGTCATAACAGTTTATAGG + Intronic
1165414305 19:35682688-35682710 GAAGGGTATTTTCAGTCTTTAGG - Intergenic
1166910610 19:46153282-46153304 GATGGGCATTTCCCGTGTATGGG + Intronic
925250065 2:2425270-2425292 GCAGAGTATTTCAAGTTTATGGG - Intergenic
926211490 2:10874024-10874046 GACGGGTGTTTCCAGATTATAGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928813910 2:35265719-35265741 GAAAGGTTTTTCCAGTTTAGTGG + Intergenic
929121935 2:38490513-38490535 CATAGGTATCTCGAGTTTATGGG + Intergenic
933212227 2:79583941-79583963 CAAGCGTATTTCCAGTTTATGGG - Intronic
938394423 2:130932072-130932094 GATGAGTATTTCCAGGGTCTGGG - Intronic
938820523 2:134953897-134953919 GATAGGTATTTTCATTTTAATGG - Exonic
942609256 2:177725720-177725742 AGTGGGTATTTCCATTATATGGG - Intronic
944345770 2:198663906-198663928 GATGGGTCATTCGAGCTTATGGG - Intergenic
945616447 2:212074624-212074646 AATGGTTATCTCCATTTTATAGG + Intronic
946008850 2:216548656-216548678 GAATGGTCTTTCCATTTTATAGG + Intronic
946944007 2:224800942-224800964 GAGGGGCACTTCCAGGTTATAGG + Intronic
948996290 2:241581241-241581263 AATGGGTAGTTCCAGGTTCTGGG + Intergenic
1168751494 20:284965-284987 GATGATTATTCCCATTTTATAGG - Intronic
1169598895 20:7233985-7234007 GAAGGATATTTCCACTGTATAGG + Intergenic
1170304334 20:14921125-14921147 GATGTGTATTACCAGTCTATTGG + Intronic
1171441081 20:25163617-25163639 TATGGTTATTTCCTGATTATAGG + Intergenic
1177170687 21:17652515-17652537 GGTGTGTTTTTCCAGTTTGTTGG - Intergenic
1179033489 21:37740482-37740504 GGTTGTTAGTTCCAGTTTATAGG - Intronic
1181336335 22:22133250-22133272 GGTGGGTGCTTCCAGTTCATAGG + Intergenic
1183114043 22:35675884-35675906 GGTGGGTGTTTCCAGTTTATAGG - Intergenic
951752442 3:26052793-26052815 GATGGGTAATTCCAGGTAAAAGG - Intergenic
952201879 3:31137914-31137936 GATGAGTAATTCCATTTTACTGG - Intergenic
952519301 3:34139612-34139634 CATGGGCATTTCTAATTTATAGG + Intergenic
955908704 3:63835723-63835745 AAAGGGTATTTCGAGTTAATTGG - Intronic
956640859 3:71414221-71414243 GATGGGGATTTCCTGTTTCCAGG + Intronic
961136790 3:124518905-124518927 GATGGGTTTTTCCAGATTAGGGG - Exonic
962116485 3:132514624-132514646 AATGGTTTTGTCCAGTTTATTGG + Exonic
963754016 3:149214408-149214430 AATTGGTATTCCCAGTGTATTGG - Intronic
966755935 3:183371397-183371419 GAGGGGGGTTTCCAGTTCATAGG + Intronic
974170094 4:58255275-58255297 AATTGGTATTGCCAGTTTATTGG - Intergenic
974712888 4:65624851-65624873 AATGATTATTTCCACTTTATTGG - Intronic
977352055 4:95901039-95901061 GATGGGTGCTTCCAGGTCATAGG + Intergenic
978432367 4:108646068-108646090 GATGGGTAGTTCAAGTTTCATGG + Intergenic
980258665 4:130418248-130418270 AATGAATATTTCCATTTTATAGG - Intergenic
981421227 4:144552428-144552450 CAAGAGTATTTCTAGTTTATTGG + Intergenic
982940570 4:161548148-161548170 GATGGGTTTTACCAGTTTTGTGG - Intronic
988184699 5:27845571-27845593 AATGGCTATATCCACTTTATTGG - Intergenic
988726356 5:33930245-33930267 GATGGGGATTTCCAGTGAAAAGG + Intergenic
990053668 5:51542150-51542172 GATTGGTATTGCCAGGTTCTGGG + Intergenic
992921116 5:81521916-81521938 GAAGGATTTTTACAGTTTATTGG + Intronic
993572851 5:89563748-89563770 GATGGCTATATCCATTTTCTAGG - Intergenic
993817705 5:92572886-92572908 GGTGGGTATTTTGAGTTTGTAGG - Intergenic
994146932 5:96405818-96405840 GATGGATATTTCTACTATATTGG + Intronic
994729857 5:103479016-103479038 AATGTGTCTTTCCAGTTTTTTGG - Intergenic
994936828 5:106264687-106264709 GATGGGTATTTCTTGAATATGGG - Intergenic
997364668 5:133318358-133318380 GATGGGTTTTTCCTTTTTCTGGG + Intronic
999227370 5:150037262-150037284 GGTAGGTATTTCCACTTTGTTGG - Intronic
1000707765 5:164532901-164532923 GATTGGTATTTAGAGTTTAGTGG - Intergenic
1005317164 6:24614322-24614344 GCTGGATATTTCCAGGGTATGGG - Intronic
1006478493 6:34273326-34273348 TATGGGGACTTGCAGTTTATGGG - Intergenic
1007063760 6:38968792-38968814 GATGTATATTTTCAGTTTTTTGG - Intronic
1008133305 6:47742777-47742799 AATTTTTATTTCCAGTTTATAGG + Intergenic
1008706871 6:54172658-54172680 TATGGCTAATTCCACTTTATAGG + Intronic
1010849962 6:80761728-80761750 GATGAAGATTTCCAGTTCATTGG - Intergenic
1011815265 6:91182004-91182026 GAATGGTGTTTCCAGATTATTGG + Intergenic
1014057508 6:117033427-117033449 GAAGGGTATGTCCATATTATTGG - Intergenic
1016295088 6:142565256-142565278 GTGGGGAGTTTCCAGTTTATAGG + Intergenic
1022520207 7:31001286-31001308 GATGGGTACTTTCAGTTCACTGG + Intergenic
1022747933 7:33191442-33191464 GGTGGATATTTACAGTTTTTTGG - Intronic
1023470206 7:40509244-40509266 CCTGGTTATTTCCAGTTTTTAGG + Intronic
1024164197 7:46714007-46714029 ACTGGGTAGTTGCAGTTTATGGG - Intronic
1033576299 7:142688366-142688388 TATGACTATTTCCATTTTATAGG - Intergenic
1034380261 7:150686220-150686242 GAAGTGTATTTCCAGCTTAAAGG + Intronic
1038169924 8:25121726-25121748 GATGATTATTCCCATTTTATAGG - Intergenic
1039644656 8:39267500-39267522 TTGGGTTATTTCCAGTTTATAGG + Intronic
1043287506 8:78552136-78552158 CATGGGTATTTGAATTTTATGGG - Intronic
1044093635 8:88033996-88034018 GATGGGTATTGCCTGTTGATAGG - Exonic
1044455708 8:92390820-92390842 GATGGATATCTTCACTTTATGGG - Intergenic
1044828965 8:96226487-96226509 GATCAGTGTTTCCAGTTTAATGG + Intronic
1045492026 8:102677229-102677251 GATGGGTATTTCATGTACATTGG - Intergenic
1045742232 8:105374854-105374876 GTAGGGTAGCTCCAGTTTATGGG + Intronic
1046707048 8:117466527-117466549 GATGGTGATTGGCAGTTTATAGG - Intergenic
1047407663 8:124598800-124598822 TTTGGGTATTTCCAGTATTTTGG - Intronic
1047659293 8:127015261-127015283 CATGGGTATTTTTAGTTTAATGG - Intergenic
1051153629 9:14115043-14115065 GATGGGTATTACAAGCCTATAGG + Intronic
1054692613 9:68330037-68330059 GAAGGGTATATTCAGTTTCTAGG + Intronic
1054998814 9:71425234-71425256 CCTGGGTATTATCAGTTTATGGG - Intronic
1056199136 9:84257707-84257729 GAAAGGTATTTCCTGTTTTTTGG - Intergenic
1059550166 9:115221022-115221044 GCTGAGTGTTTACAGTTTATAGG + Intronic
1062668958 9:137695081-137695103 GATGGGAATTTGGAGTTTTTGGG + Intronic
1185849332 X:3470588-3470610 TATGGTTATTTCCTGATTATAGG - Intergenic
1187018299 X:15352194-15352216 GGTTGCTATTTACAGTTTATAGG + Intronic
1187175480 X:16892651-16892673 GCTGGGAATTTTCAGTTTTTAGG + Intergenic
1192173218 X:68869722-68869744 GATTGTTATCTCCAGTTTAGAGG - Intergenic
1194383822 X:93228307-93228329 AATGAGTATTTCCAGGTTGTGGG - Intergenic
1195242404 X:102965535-102965557 AAAGGGTATTCCCAGTGTATAGG + Intergenic
1195493081 X:105496156-105496178 GCAGGGGACTTCCAGTTTATAGG - Intronic
1195888151 X:109663210-109663232 GATGGATGTTTACAGATTATAGG - Exonic
1197255294 X:124256683-124256705 GATAGCTATTTCCAGTTTAATGG - Intronic