ID: 1135209865

View in Genome Browser
Species Human (GRCh38)
Location 16:20516044-20516066
Sequence ACAAGCTCTGTGGCCAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135209865_1135209874 10 Left 1135209865 16:20516044-20516066 CCATACTTGGCCACAGAGCTTGT No data
Right 1135209874 16:20516077-20516099 TCTTGGGTTTGGGGGTTATTGGG No data
1135209865_1135209875 11 Left 1135209865 16:20516044-20516066 CCATACTTGGCCACAGAGCTTGT No data
Right 1135209875 16:20516078-20516100 CTTGGGTTTGGGGGTTATTGGGG No data
1135209865_1135209870 0 Left 1135209865 16:20516044-20516066 CCATACTTGGCCACAGAGCTTGT No data
Right 1135209870 16:20516067-20516089 AATCATTACTTCTTGGGTTTGGG No data
1135209865_1135209871 1 Left 1135209865 16:20516044-20516066 CCATACTTGGCCACAGAGCTTGT No data
Right 1135209871 16:20516068-20516090 ATCATTACTTCTTGGGTTTGGGG No data
1135209865_1135209867 -7 Left 1135209865 16:20516044-20516066 CCATACTTGGCCACAGAGCTTGT No data
Right 1135209867 16:20516060-20516082 AGCTTGTAATCATTACTTCTTGG No data
1135209865_1135209876 18 Left 1135209865 16:20516044-20516066 CCATACTTGGCCACAGAGCTTGT No data
Right 1135209876 16:20516085-20516107 TTGGGGGTTATTGGGGCTTGTGG No data
1135209865_1135209868 -6 Left 1135209865 16:20516044-20516066 CCATACTTGGCCACAGAGCTTGT No data
Right 1135209868 16:20516061-20516083 GCTTGTAATCATTACTTCTTGGG No data
1135209865_1135209869 -1 Left 1135209865 16:20516044-20516066 CCATACTTGGCCACAGAGCTTGT No data
Right 1135209869 16:20516066-20516088 TAATCATTACTTCTTGGGTTTGG No data
1135209865_1135209872 2 Left 1135209865 16:20516044-20516066 CCATACTTGGCCACAGAGCTTGT No data
Right 1135209872 16:20516069-20516091 TCATTACTTCTTGGGTTTGGGGG No data
1135209865_1135209873 9 Left 1135209865 16:20516044-20516066 CCATACTTGGCCACAGAGCTTGT No data
Right 1135209873 16:20516076-20516098 TTCTTGGGTTTGGGGGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135209865 Original CRISPR ACAAGCTCTGTGGCCAAGTA TGG (reversed) Intergenic
No off target data available for this crispr