ID: 1135210171

View in Genome Browser
Species Human (GRCh38)
Location 16:20519091-20519113
Sequence GGTTAATTAAGACCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135210171_1135210173 24 Left 1135210171 16:20519091-20519113 CCAGATTTTGGTCTTAATTAACC No data
Right 1135210173 16:20519138-20519160 GTGTTTGACAACCTTTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135210171 Original CRISPR GGTTAATTAAGACCAAAATC TGG (reversed) Intergenic
No off target data available for this crispr