ID: 1135213457

View in Genome Browser
Species Human (GRCh38)
Location 16:20543679-20543701
Sequence CAGGGTCCCAGGGGGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135213457_1135213465 6 Left 1135213457 16:20543679-20543701 CCAGGAAGCCCCCTGGGACCCTG No data
Right 1135213465 16:20543708-20543730 GTGCATATTTCTACAATAGCTGG No data
1135213457_1135213467 26 Left 1135213457 16:20543679-20543701 CCAGGAAGCCCCCTGGGACCCTG No data
Right 1135213467 16:20543728-20543750 TGGGTCCCTCTATTCAGCTGAGG No data
1135213457_1135213466 7 Left 1135213457 16:20543679-20543701 CCAGGAAGCCCCCTGGGACCCTG No data
Right 1135213466 16:20543709-20543731 TGCATATTTCTACAATAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135213457 Original CRISPR CAGGGTCCCAGGGGGCTTCC TGG (reversed) Intronic
No off target data available for this crispr