ID: 1135214410

View in Genome Browser
Species Human (GRCh38)
Location 16:20552433-20552455
Sequence ATGTTTAAGTATAAGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135214408_1135214410 -4 Left 1135214408 16:20552414-20552436 CCTGCAGGTTTATAGGCATATGT 0: 2
1: 0
2: 0
3: 7
4: 102
Right 1135214410 16:20552433-20552455 ATGTTTAAGTATAAGTAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135214410 Original CRISPR ATGTTTAAGTATAAGTAGGA AGG Intronic
900005166 1:40518-40540 ATTTTTAAGTACAAGTCTGAAGG - Intergenic
902065513 1:13682424-13682446 ATATTTAAGGGGAAGTAGGATGG + Intergenic
904408070 1:30306737-30306759 AGGTGTAAGTATAGGTAGCATGG - Intergenic
907120928 1:52007337-52007359 ATTTTTAAGGATAATTTGGAGGG + Intergenic
907893605 1:58661900-58661922 ATTTTTAATTATCACTAGGATGG - Intronic
909168300 1:72257538-72257560 ATCTTTAAATATATGGAGGAGGG - Intronic
909168649 1:72263132-72263154 ATATTTAAGTATATGTAGATGGG - Intronic
910823788 1:91383296-91383318 ATGTTTAATTATCTGTACGATGG - Intronic
911618102 1:100037302-100037324 ATGTGTATGTATATGTAGGTGGG - Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
916159613 1:161895844-161895866 ATGATTTGGTATGAGTAGGAGGG + Intronic
916200494 1:162266613-162266635 ATGTTTAAGACTCAGTAGCAAGG - Intronic
916338569 1:163701394-163701416 ATGTTTAAGTAGACATAGTATGG - Intergenic
922520753 1:226249789-226249811 TTGCTTAAGGATATGTAGGATGG - Intronic
922573068 1:226645095-226645117 ATGTTCCAGTGTAAGCAGGAGGG - Intronic
923832380 1:237572165-237572187 ATGTCAAAGTATTAGTGGGAAGG + Intronic
1063729893 10:8684679-8684701 ATTTTTAAAAATAAGGAGGAGGG + Intergenic
1063771519 10:9208159-9208181 ATGTTTAAGTTTAGCTAGCACGG - Intergenic
1064548146 10:16471753-16471775 ATGTTTACATATAAACAGGATGG - Intronic
1064551837 10:16509209-16509231 ATCTTTTAGTGTAAGCAGGACGG + Intronic
1065062068 10:21912689-21912711 CTGTTTAACTCTAAGTAGAAGGG + Intronic
1065491531 10:26287131-26287153 ATGTTTAAATGTAAGCAGGCTGG + Intronic
1065902066 10:30217170-30217192 ATGTTTCAGTTTAAGTCTGAAGG - Intergenic
1066074560 10:31860079-31860101 ATGTTTAACTATAACAAGAAAGG - Intronic
1066396011 10:35022454-35022476 ATGTTTAAGCAGAAGTAACAGGG + Intronic
1068145090 10:53059172-53059194 ATGTTTATGCAAAAGAAGGAAGG - Intergenic
1068325977 10:55486929-55486951 ATGTTGAAGTTTTAGTAGGTAGG - Intronic
1068528703 10:58160789-58160811 ATTTTTAACTATAAGTTGCAAGG - Intergenic
1068936433 10:62639724-62639746 ATCTGTGAGTCTAAGTAGGATGG + Intronic
1069195301 10:65544130-65544152 CTGATTAAGAATAAGAAGGAGGG - Intergenic
1071031516 10:81189378-81189400 ATTTTTAAGTAAAAGTGGAAAGG + Intergenic
1071154599 10:82674485-82674507 ATGTTTAAGTGTCAGTAAAAAGG - Intronic
1071911863 10:90245513-90245535 ATGATTAATTCTAAGTGGGAAGG + Intergenic
1078193691 11:9116323-9116345 ATGTTTAAGTTTAACAAGGCAGG - Intronic
1080908996 11:36576080-36576102 AAGTTCAAGTATAGGTATGAGGG + Exonic
1081710924 11:45214829-45214851 ATGTTTAAGGAAAAGCAGGTTGG + Intronic
1081824838 11:46039244-46039266 CTGTTTTAGTATAGGTAGGGTGG + Intronic
1082954608 11:58856501-58856523 ATGATTAAGCATAGGGAGGAAGG - Intronic
1086474233 11:87153290-87153312 ATGTTTGAGTACAAATAAGATGG - Intronic
1087254933 11:95943028-95943050 AAGTTTAAGTAGTAGTAGAATGG - Intergenic
1087665651 11:101044600-101044622 ATGATTAAGCTTAATTAGGAAGG - Intronic
1088295004 11:108283415-108283437 ATGTTTAGGTATCAGGATGATGG + Intronic
1089406129 11:118199150-118199172 ATTTTTAATTATAAGCAAGACGG + Intronic
1091379151 12:44693-44715 ATTTTTAAGTACAAGTCTGAAGG - Intergenic
1092292331 12:7169071-7169093 AGGTGTAAGTATAAGTAGCAAGG - Intergenic
1092564488 12:9649742-9649764 CTGTCTCAGTATTAGTAGGAGGG + Intergenic
1093658847 12:21729933-21729955 ATGTTGAAGTATATTTAAGAAGG + Intronic
1093970545 12:25371588-25371610 ATGATTAAATAGAAGTGGGAGGG + Intergenic
1094350525 12:29519679-29519701 TTGTTGAAGTAAAAGGAGGAGGG + Intronic
1094746324 12:33348301-33348323 ATGTTTTAGTACAAGTACCACGG - Intergenic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1097759742 12:63449322-63449344 ATGTTTAAGTATAAATTTCAAGG - Intergenic
1097953247 12:65456094-65456116 AAGGTAAACTATAAGTAGGATGG + Intronic
1103669700 12:122603301-122603323 ATCTTTAAGGAGAAGCAGGATGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107420338 13:40240131-40240153 ATGTTTTAGGATCAGCAGGAAGG - Intergenic
1109489074 13:63071221-63071243 ATGTTCAAGGATCAGTAAGAAGG - Intergenic
1109878663 13:68440918-68440940 AAGTTTAATTATTAGTAAGAAGG + Intergenic
1112026018 13:95411869-95411891 TTGTTTATTTATAAGTAGAAAGG + Intergenic
1112823907 13:103369593-103369615 ATGTATAAGTGTTATTAGGAGGG + Intergenic
1113756236 13:112812933-112812955 ATGTTTAGCTACAAGTATGAAGG - Intronic
1116239624 14:42324187-42324209 AGGTGTAAGTATAGGTAGCACGG + Intergenic
1116534184 14:46010178-46010200 ACATTTAAGTATAATTAGAATGG - Intergenic
1116599072 14:46895423-46895445 ATTTTTAAGAATAACTAGGTTGG + Intronic
1117279578 14:54225217-54225239 ATGTTTATGTGTATGTAGAAAGG + Intergenic
1121343473 14:93118399-93118421 ATCTTGAAGGATGAGTAGGAAGG + Intergenic
1121960085 14:98251527-98251549 ATGTTTAAGTAGGAGTAAGAAGG + Intergenic
1124717162 15:32074055-32074077 ATTTTTAACAATAAGAAGGAAGG - Intronic
1125143809 15:36442009-36442031 CTGTTTAAGAATAAGTATGCAGG - Intergenic
1125652449 15:41328675-41328697 ATGTTTAAATAAATGTCGGAGGG + Intronic
1131301104 15:91200358-91200380 ATGTTCAAATATAATTAGAAGGG + Intronic
1131835201 15:96383539-96383561 ATGTTTAGGTAAAAGGAGGGAGG - Intergenic
1132448347 15:101950426-101950448 ATTTTTAAGTACAAGTCTGAAGG + Intergenic
1135204476 16:20471378-20471400 ATGTCTATGTATAAGTAGGAAGG - Intronic
1135214410 16:20552433-20552455 ATGTTTAAGTATAAGTAGGAAGG + Intronic
1135579544 16:23613691-23613713 ATGTTTAAGTAGCCTTAGGAAGG - Intronic
1137366956 16:47868712-47868734 ATGTGTATGTGTAAGTAGGTAGG - Intergenic
1139058952 16:63224561-63224583 ATTTTTTAGTCTAAGTAGTAGGG + Intergenic
1140168235 16:72576779-72576801 ATGATAAAGTATAAGCAGGAAGG + Intergenic
1140611443 16:76604022-76604044 ATGATTAAGTAAAAAAAGGAAGG + Intronic
1144870459 17:18366616-18366638 AAATTTAAGTATCAGTAGGCCGG - Intergenic
1146134440 17:30306255-30306277 ATGTTTAAGTATAATAATTATGG + Intergenic
1146795956 17:35781088-35781110 ATGTTTAAGGAACAGAAGGAAGG + Intronic
1147368876 17:39977696-39977718 TTGGGGAAGTATAAGTAGGAGGG - Exonic
1149040139 17:52178336-52178358 ATCATGAAGTATAAATAGGAAGG + Intergenic
1149978991 17:61294370-61294392 ATGTTTAAAGATACTTAGGATGG - Intronic
1150036638 17:61807429-61807451 ATTATAAAGTATAAGTAGTAAGG - Intronic
1150944266 17:69727446-69727468 ATGTTTAAGCATGATTATGATGG - Intergenic
1153481903 18:5555439-5555461 ATTTTTCAGAATAAGTAGCATGG + Intronic
1155019429 18:21881472-21881494 AAGTTCAGGTAGAAGTAGGAAGG + Intergenic
1155121755 18:22827914-22827936 ATGTTTAAGTATTTGTTGCAGGG + Intronic
1155620070 18:27768285-27768307 AAGTTTCAGTCTCAGTAGGAAGG + Intergenic
1158365654 18:56732048-56732070 ATGTTTCAGAATACGTATGATGG + Intronic
1158928623 18:62297854-62297876 ATGTTTAAGTAAAAACATGAAGG - Intronic
1159128563 18:64253889-64253911 ATGTTTAAATATGAGCAAGAGGG - Intergenic
1159700517 18:71620935-71620957 ATGTTTAAGCTTAATGAGGAAGG - Intergenic
1160636920 19:82127-82149 ATTTTTAAGTACAAGTCTGAAGG - Intergenic
925775339 2:7329920-7329942 ATGTTTTAGGATAGGTAGGGTGG + Intergenic
926442973 2:12909591-12909613 ATTTTTAAGAATAACTAGGCTGG - Intergenic
927001711 2:18802146-18802168 ATGTCAAAGTATGAGTAGAAAGG - Intergenic
927448052 2:23183186-23183208 ATGATTAAGTAGAGGCAGGAAGG - Intergenic
928197593 2:29226661-29226683 ATGTTTAAGTGGAGGCAGGATGG + Intronic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
929268173 2:39942118-39942140 ATTTTTAAGTTTAAGTAGAAAGG + Intergenic
929884282 2:45864397-45864419 ATGTTGAAGGATAAGAAGAAAGG - Intronic
930264904 2:49188272-49188294 ATATTTAAGTATAAGAAGTGTGG - Intergenic
931023881 2:58085611-58085633 ATGTTTAAGAATAAGAGTGATGG + Intronic
931296032 2:60926759-60926781 ATGATTAAGTATGAGTGTGATGG - Exonic
931545792 2:63385180-63385202 ATCTTTCACTATAAGTATGATGG - Intronic
931686294 2:64796954-64796976 ATGCTTAAGTGTAAATGGGAAGG + Intergenic
932692563 2:73925802-73925824 ATGTTGATGTATATATAGGATGG - Intergenic
933416516 2:81993414-81993436 ATTTTTAAGAATAAGTCAGAAGG - Intergenic
935020214 2:99223065-99223087 CTGTGTAAGTAAAAATAGGATGG - Intronic
935176105 2:100649889-100649911 ATTTTTAAGTTTAATGAGGAAGG + Intergenic
936564556 2:113572914-113572936 ATTTTTAAGTACAAGTCTGAAGG + Intergenic
937760610 2:125598067-125598089 ATATTTAAGTAAAAATAGTAAGG + Intergenic
940536346 2:154949898-154949920 ATGTTTAAATATACATATGAAGG + Intergenic
940948399 2:159644923-159644945 ATATTTTACTATAAGTAGTAAGG + Intergenic
941562238 2:167060983-167061005 ATATATAAGCATAAATAGGAAGG - Intronic
941900543 2:170674003-170674025 ATTTTTCAGTATAATCAGGAGGG - Intergenic
942999302 2:182304527-182304549 ATGATTAAGTTTAACGAGGAAGG - Intronic
945063032 2:205925047-205925069 ACGTTTAAGAAAAAGTAGAAAGG + Intergenic
946687722 2:222288523-222288545 ATTTTTATGTAAAAGTAGGTAGG - Intronic
946914013 2:224496936-224496958 ATATTTAAGTGTAAGTGGGAAGG - Intronic
947557908 2:231113599-231113621 ATGTTAATGTATCAGTAGGCTGG + Intronic
1170392722 20:15892732-15892754 AAGTTTAAGTCTATGTAGGTTGG + Intronic
1170397148 20:15938734-15938756 ATGTTTAAGCTTAATGAGGAAGG + Intronic
1172922821 20:38500650-38500672 ATGATTAAGTTTAATTAGGAAGG + Intronic
1174941021 20:54927262-54927284 ATGTTGAAGTAAACATAGGAAGG - Intergenic
1175230067 20:57468146-57468168 ATTTTTTAGTATAAGTATGTCGG - Intergenic
1176925857 21:14748075-14748097 ATGTTTAAGAATAAGAAAAATGG + Intergenic
1181260514 22:21593853-21593875 ATGTTTAAGAGTGAGGAGGAAGG - Intronic
1182769829 22:32786660-32786682 TTGTTTAAGAATAAGTTGCAGGG - Intronic
950011393 3:9726713-9726735 ATGTTTGAGGGTGAGTAGGAAGG + Exonic
951170226 3:19533264-19533286 ATGTTTAAGAATAAATAAGTAGG + Intronic
951381778 3:21993712-21993734 ATGTTTTTGTATTAGTAGGAAGG - Intronic
951400835 3:22229956-22229978 AGGTGTAAGTATAGGTAGCAAGG - Intronic
952237434 3:31494354-31494376 ATGTTTCAGTGTAAGCAGCACGG - Intergenic
953673694 3:44983492-44983514 AGATTTAAGTATAATTTGGAAGG + Intronic
955456805 3:59130736-59130758 ATGTCTAAGCATAAATAAGATGG - Intergenic
955695211 3:61629053-61629075 AAGTTTAGGGAGAAGTAGGAGGG + Intronic
956864686 3:73357245-73357267 AGGTATAAGTAGAAGTAGGGTGG - Intergenic
957797494 3:85030642-85030664 ATATATAAATATAAGTAAGATGG - Intronic
957970884 3:87380716-87380738 ATGTTTCAGTAAAGGTATGAGGG - Intergenic
959671640 3:108984628-108984650 ATGTTTAAATACAAGAAGAAAGG - Intronic
961485828 3:127215498-127215520 ATGTTCAAGTATCCATAGGAAGG + Intergenic
962548614 3:136465037-136465059 AAGTTTAAATAAAAGTAGAAAGG - Intronic
963472414 3:145757741-145757763 ATGTCTAAGGATAGGTAGGATGG + Intergenic
963631989 3:147744990-147745012 AAATTTAATTTTAAGTAGGATGG + Intergenic
965424504 3:168505136-168505158 ATGATTAAGTTTAATGAGGAAGG - Intergenic
966089020 3:176108035-176108057 GTGTTTAAAGATAAGTAAGAGGG + Intergenic
971133865 4:23845045-23845067 ACGTATAGGTATAAGCAGGAGGG + Intronic
971921308 4:32943201-32943223 ATGTTTAAGCTTAATGAGGAAGG + Intergenic
972223313 4:36981740-36981762 ATGTTTAAGTGTATGTATGTTGG - Intergenic
974566652 4:63586301-63586323 TTGTTAAAGTATATGGAGGATGG - Intergenic
975508254 4:75163581-75163603 ATCTTAAAGAATAAGTAAGAGGG - Intergenic
976945815 4:90766188-90766210 ATGTTCAAATATAAGTAGGCTGG - Intronic
977310167 4:95376159-95376181 ATGTGTAAGTATATATAGAAAGG - Intronic
977970651 4:103210173-103210195 TTGTTATAGTATAAGTAGAAGGG + Intergenic
978346428 4:107774961-107774983 ATGTCTAAGCATTAGTAGAATGG - Intergenic
978588515 4:110299124-110299146 ATGTTTCAATAGAAATAGGATGG + Intergenic
979938081 4:126722642-126722664 ATGTTTCAGTCTAAGTCTGAAGG + Intergenic
980102105 4:128552060-128552082 AGGTGTAAGTAAATGTAGGATGG - Intergenic
980187507 4:129480621-129480643 GTGTTTAGGTATAAGAAAGAGGG - Intergenic
980461308 4:133117959-133117981 ATGGTTAAAAATAAGTTGGAAGG + Intergenic
981744704 4:148041196-148041218 ATGTTTAAGAATGAGGAGCATGG + Intronic
982470087 4:155778082-155778104 ATGTTTAGGAAAAAGTAGTAGGG + Intronic
982976151 4:162064553-162064575 ATGTTTTAGTATGAGTTTGAAGG - Intronic
983105193 4:163678155-163678177 ATGTTTTAGTATAAGAAATAGGG - Intronic
983291485 4:165812583-165812605 ATGTTTAAGAATAATTACAATGG + Intergenic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
983343405 4:166495882-166495904 ATGTTTAAGTATTAGCATGCAGG + Intergenic
983604298 4:169568633-169568655 ATATTTGAATATAAATAGGAAGG + Intronic
983864015 4:172741739-172741761 AAGTTTAAATATATGTAGCAGGG - Intronic
984434611 4:179693316-179693338 ATAATTGAGTATAAATAGGAAGG - Intergenic
989184638 5:38611539-38611561 ATGTTTAGGAATTAGTAGGAAGG + Intergenic
989377182 5:40776736-40776758 ATGTTCAGGTATAAGCAGGATGG + Intronic
990652059 5:57912087-57912109 AGTTTTAAGTATAAGAAAGAAGG - Intergenic
992789173 5:80198399-80198421 GTGTTTAAGTTTGAGTAAGAGGG - Intronic
993396236 5:87392708-87392730 ATGTTAAAATATAAGAAGCAGGG - Intronic
993760639 5:91792562-91792584 ATGTTTATGTATGAGGAGAAGGG - Intergenic
993844389 5:92922460-92922482 ATGTTAAAGAAACAGTAGGAAGG + Intergenic
994488775 5:100414727-100414749 ATGTGTTTGTATAAGTAGCATGG + Intergenic
994761634 5:103861664-103861686 ATGATTAAGTTAAAGTATGAAGG + Intergenic
994888401 5:105597326-105597348 ATGTATATGTATATGTATGATGG + Intergenic
995714350 5:115067595-115067617 ATCTTTAGTTATAAGTGGGAAGG - Intergenic
996221303 5:120936410-120936432 GTGTTAAAACATAAGTAGGATGG - Intergenic
996602666 5:125283965-125283987 ATGTGTAATTATAAGTTGCAAGG + Intergenic
1001831694 5:174794386-174794408 ATGTCTTTGTAAAAGTAGGAGGG + Intergenic
1001929263 5:175661161-175661183 ATCTTGAAGGATGAGTAGGATGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003768976 6:9275740-9275762 ATGTTTCAGTTTAAGTCTGAAGG + Intergenic
1004199979 6:13539060-13539082 ATGTTAAAGTGTAAAAAGGAAGG - Intergenic
1004468085 6:15904409-15904431 ATTTTTAAGTATAATTTGGTGGG + Intergenic
1004567251 6:16809360-16809382 GAGTTTAAGTTTAAGTAGGAAGG + Intergenic
1005827614 6:29644244-29644266 CTGAATAATTATAAGTAGGATGG + Intergenic
1006244471 6:32718377-32718399 ATGTTTAAGTAAAAAAAGAAAGG - Intergenic
1008342309 6:50382376-50382398 TTGTTATAGTATAAGTAGAAGGG + Intergenic
1009449414 6:63784053-63784075 ATGTTTCAGTCCAAGTACGAAGG - Intronic
1011755220 6:90491917-90491939 AAGTCTAAGTTTAAGGAGGAAGG - Intergenic
1012762519 6:103320130-103320152 AAGTTACAGTATACGTAGGAAGG - Intergenic
1012817992 6:104048761-104048783 ATGTTTAAGTATGAGGGAGAAGG - Intergenic
1014363814 6:120515151-120515173 ATGTTTAATTATTTGTAGAATGG - Intergenic
1014615486 6:123593043-123593065 ATGTTTAATTAGAAGTAACATGG - Intronic
1016933801 6:149433973-149433995 ATGGTTAACTAAAACTAGGAGGG - Intergenic
1018344311 6:162884933-162884955 CTGTTTAAGTGTAAGTGGCATGG - Intronic
1018914406 6:168124044-168124066 ATGTATCAGTATAAGTAAGTGGG - Intergenic
1021015585 7:15527158-15527180 ATGATTAAGCTTAAGAAGGAAGG + Intronic
1021415827 7:20383384-20383406 ATGACTAAGTAGAAGTAGGTGGG - Intronic
1021525456 7:21581484-21581506 ATCTATAAGTTTAAATAGGAAGG - Intronic
1021611855 7:22465526-22465548 AAGTTGTAGTATTAGTAGGATGG - Intronic
1021997679 7:26196123-26196145 ATTCTTACGTATAAATAGGATGG - Intronic
1022836872 7:34126241-34126263 ATTTTTAAGGAAAAGCAGGAAGG + Intronic
1024388291 7:48778674-48778696 ATGTTTTAGTACAAGTCTGAAGG + Intergenic
1027473173 7:78597653-78597675 ATGGTTAGGTAAAAGCAGGAAGG - Intronic
1028344865 7:89767265-89767287 ATGATTAAGAATAATAAGGAAGG + Intergenic
1029336946 7:99909233-99909255 ATATTTAGGAAAAAGTAGGAAGG + Intronic
1031255446 7:119441665-119441687 ATGGATAAATATATGTAGGAAGG - Intergenic
1031844505 7:126788490-126788512 AAGATGTAGTATAAGTAGGATGG - Intronic
1032480213 7:132240053-132240075 ATTTTCAAGTATAAGAAGGTGGG - Intronic
1032576938 7:133064528-133064550 CTGTTTAAAAATAACTAGGAGGG + Intronic
1032809306 7:135394480-135394502 ATGTTTAACTTTCAGTAGCATGG - Intronic
1032826628 7:135576065-135576087 GTGTTTAGGGATAAGTTGGATGG + Intronic
1035053628 7:156019098-156019120 ATGTTTAAGTAAATGAAGGAAGG + Intergenic
1035760144 8:2062763-2062785 ATGTTTAGGGGTAAGTAGGTTGG + Intronic
1035825511 8:2640449-2640471 ATTTTTAAGTGAAAATAGGATGG + Intergenic
1035854175 8:2956035-2956057 ATGTATAAATATATATAGGATGG - Intronic
1037193311 8:16154254-16154276 AGGTCTAATTATAAGTAGAATGG - Intronic
1039503948 8:38038092-38038114 CTGTATGAGGATAAGTAGGAGGG - Intronic
1040394869 8:46987706-46987728 ACCTTTAAGGATAGGTAGGATGG - Intergenic
1040425624 8:47282817-47282839 ATGATTAAGCTTAGGTAGGAAGG - Intronic
1040503930 8:48029942-48029964 ATTTCTAAGTAAAATTAGGATGG - Intronic
1046184576 8:110695930-110695952 ATGTTTAAAAATAACTAGTATGG + Intergenic
1046698620 8:117374043-117374065 AAATTTAAGTATATGTAGAAGGG + Intergenic
1048141297 8:131797245-131797267 AGGGTTAAATTTAAGTAGGAGGG + Intergenic
1049887862 9:40300-40322 ATTTTTAAGTACAAGTCTGAAGG - Intergenic
1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG + Intronic
1050785831 9:9400442-9400464 ATGTTGTAGTATTAGAAGGACGG - Intronic
1052210005 9:25892915-25892937 CTGATTAAGTATAAGGAGTAAGG + Intergenic
1052501396 9:29295778-29295800 AGTTTTAAGGATAAGTAGGATGG - Intergenic
1053125396 9:35576757-35576779 AGGTTTAAGTATAGGTAAGAAGG - Intergenic
1055270521 9:74552989-74553011 ATGTTCAAGTATCAGAAAGAAGG + Intronic
1055529826 9:77172888-77172910 AAGGTTAAGTATAAGTAGGATGG - Intergenic
1057287593 9:93772480-93772502 ATGTTTCAGAATAAGTACAAAGG - Intergenic
1058747491 9:108006326-108006348 ATGTTAAAGTATATTCAGGAAGG - Intergenic
1059615462 9:115946095-115946117 ATGTTTAAAACTAAGTTGGAAGG + Intergenic
1203624650 Un_KI270750v1:2401-2423 ATGTTCAAGGATCAGTAAGAAGG - Intergenic
1185933494 X:4229746-4229768 ATGTTTATTTATAAGTAGGTAGG - Intergenic
1187261747 X:17691124-17691146 ATGTTTAAGATTGTGTAGGAGGG + Intronic
1187664272 X:21586670-21586692 ATTTTTAAGTAAAAACAGGAAGG + Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188056905 X:25552159-25552181 CTGATTAAGTATATGTAGGGTGG + Intergenic
1189927355 X:45970743-45970765 ATGTTTAAGGAATAGTAAGATGG + Intergenic
1191675741 X:63790619-63790641 ATGATTAAGTAGATGTGGGATGG - Intergenic
1195287825 X:103402581-103402603 ATTTTTTAGTGTAAGTATGATGG - Intergenic
1195433877 X:104819918-104819940 ATCTCTAAGTATAAATATGAGGG + Intronic
1196367126 X:114935775-114935797 ATGTTTCAGTTCAAGTATGAGGG - Intergenic
1199181728 X:144864613-144864635 ATATTTAGGTATAAATATGATGG - Intergenic
1200689761 Y:6295102-6295124 ATGTTAAATTCTAAGTATGAAGG + Intergenic
1201045511 Y:9879618-9879640 ATGTTAAATTCTAAGTATGAAGG - Intergenic