ID: 1135215093

View in Genome Browser
Species Human (GRCh38)
Location 16:20559232-20559254
Sequence TGGGCTGCATTCGAGCAGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135215093_1135215102 8 Left 1135215093 16:20559232-20559254 CCAACCTGCTCGAATGCAGCCCA 0: 2
1: 0
2: 0
3: 11
4: 90
Right 1135215102 16:20559263-20559285 AGCCACCACTCAGGCACTCGGGG 0: 2
1: 2
2: 2
3: 15
4: 141
1135215093_1135215100 6 Left 1135215093 16:20559232-20559254 CCAACCTGCTCGAATGCAGCCCA 0: 2
1: 0
2: 0
3: 11
4: 90
Right 1135215100 16:20559261-20559283 CCAGCCACCACTCAGGCACTCGG 0: 2
1: 0
2: 1
3: 24
4: 257
1135215093_1135215101 7 Left 1135215093 16:20559232-20559254 CCAACCTGCTCGAATGCAGCCCA 0: 2
1: 0
2: 0
3: 11
4: 90
Right 1135215101 16:20559262-20559284 CAGCCACCACTCAGGCACTCGGG 0: 2
1: 0
2: 2
3: 28
4: 222
1135215093_1135215098 -1 Left 1135215093 16:20559232-20559254 CCAACCTGCTCGAATGCAGCCCA 0: 2
1: 0
2: 0
3: 11
4: 90
Right 1135215098 16:20559254-20559276 AGGATCACCAGCCACCACTCAGG 0: 2
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135215093 Original CRISPR TGGGCTGCATTCGAGCAGGT TGG (reversed) Exonic
900117837 1:1036034-1036056 TGGGGTCCTTTCCAGCAGGTGGG + Intronic
901783579 1:11610143-11610165 TGGCCTGCAGTCAAGCAGGGGGG + Intergenic
902870207 1:19309560-19309582 TGTTCTGCATCCGAGCAGCTTGG + Intronic
905317523 1:37092989-37093011 TGGGCTGCAGTATGGCAGGTGGG - Intergenic
905960543 1:42038914-42038936 TGGGCTGGATGGGAGCAGGGAGG - Intergenic
907155579 1:52330770-52330792 TGGGCTGCATCCCAGGAGGTTGG - Intronic
910647023 1:89525005-89525027 GGGGCTGGAGTCGCGCAGGTAGG + Exonic
911092189 1:94026457-94026479 TGGGCTGCAAACTTGCAGGTGGG + Intronic
912071672 1:105818258-105818280 TGGGCAGTATTTGAGCAAGTGGG - Intergenic
914329131 1:146649729-146649751 TGGGCTGCATCTGTGCAGGGGGG - Intergenic
915154809 1:153866515-153866537 TGGTTTGCATTAGGGCAGGTTGG - Intronic
1062854358 10:772312-772334 TGGGCTGCTTGCGAGGAGGGAGG + Intergenic
1063417058 10:5882202-5882224 TGTCCTGCTTTCGAGCAGCTGGG - Intronic
1067044829 10:42979631-42979653 GGGGCTGCCAGCGAGCAGGTGGG - Intergenic
1067221997 10:44350963-44350985 TGGGGTGCATGCAAGCAGGCAGG - Intergenic
1067978115 10:51049190-51049212 TGTGCTGAGTTTGAGCAGGTAGG + Intronic
1068430708 10:56928623-56928645 TAGACTGCATTCGTGCAAGTAGG + Intergenic
1070682810 10:78461053-78461075 TGGGCTGCAGTGGGGGAGGTAGG + Intergenic
1073144900 10:101274090-101274112 TGAGCTGCATGTCAGCAGGTTGG + Intergenic
1076198084 10:128534964-128534986 TGGGCAGGATTCTAGCAGCTGGG + Intergenic
1080637738 11:34138476-34138498 TGGGCTGCTTCCGTGCAGGCAGG + Intronic
1083319543 11:61837494-61837516 TAGGCTGCCTTTGGGCAGGTCGG - Intronic
1083727209 11:64634811-64634833 TGGGCTGCCCTGGGGCAGGTAGG + Intronic
1083821730 11:65175415-65175437 TGGGCTCCATTGGAGGTGGTGGG + Intergenic
1086900947 11:92366867-92366889 TGGGCTTCATTAGAGGTGGTGGG + Intronic
1088780299 11:113127812-113127834 TGGGCTGCCTTTCAGCAGGTGGG + Intronic
1089358173 11:117869408-117869430 GGGGCAGCATTCGAGCCGTTGGG - Intronic
1089784498 11:120898425-120898447 TGGGCTGCATGTGAGCAGGGAGG - Intronic
1091804950 12:3349203-3349225 TGGGCTTCATTCGTGGGGGTTGG - Intergenic
1092507955 12:9124265-9124287 TTGGCTGCAGTGGAGCCGGTGGG + Intergenic
1096865128 12:54558181-54558203 GGTGCTGCATTCGAGAAGCTGGG - Intronic
1099133614 12:78865150-78865172 TGGGATGGATTCGAGCAGATAGG - Intronic
1107624810 13:42271876-42271898 CGGGCTGCACTGGAGCACGTGGG + Intergenic
1114167078 14:20230511-20230533 TGTGCTCCATGGGAGCAGGTTGG + Intergenic
1114631962 14:24164853-24164875 TGGGGTGCATTCCAGGAGATGGG - Exonic
1119121599 14:72084332-72084354 TGGGCTGCATAGCAGGAGGTGGG - Intronic
1122000082 14:98640706-98640728 GGTGCTGCAGTCGAGGAGGTGGG - Intergenic
1122774109 14:104109686-104109708 GGGGCTGCATTTGGGGAGGTTGG + Intronic
1124123331 15:26911516-26911538 TGGGCTTCATTCTAGCTGTTTGG - Intronic
1130066972 15:80613007-80613029 TGGGCCGCATGCGTTCAGGTTGG - Intergenic
1132923339 16:2411936-2411958 TGGGCTGCATCTGCGGAGGTGGG - Intergenic
1135159285 16:20079231-20079253 TGGGCTGCATTCCAGAAGTTAGG + Intergenic
1135203912 16:20465710-20465732 TGGGCTGCATTCGAGCAGGTTGG + Exonic
1135215093 16:20559232-20559254 TGGGCTGCATTCGAGCAGGTTGG - Exonic
1140004433 16:71061204-71061226 TGGGCTGCATCTGTGCAGGGGGG + Intronic
1141840594 16:86571836-86571858 TGGGCAGCAGACGAGCAGGGTGG - Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1143111673 17:4556318-4556340 TGGGCTGATGTGGAGCAGGTGGG + Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1152240750 17:79159671-79159693 TGGGCTGCATGCCCGCAGCTGGG + Intronic
1155339722 18:24801658-24801680 TGGGCTGTATTTGGGAAGGTAGG + Intergenic
1159217115 18:65407556-65407578 GGTGCTGCAGTCGAGGAGGTGGG + Intergenic
1162359121 19:10206952-10206974 TGGGCTGCAGCGGAGAAGGTAGG - Intronic
1168510835 19:56972391-56972413 TGGGCTTCACTCTAGCATGTGGG + Intergenic
925108871 2:1316700-1316722 AGGCCAGCATTCGAGAAGGTTGG + Intronic
925108879 2:1316744-1316766 AGGGCAGCATTGGAGAAGGTTGG + Intronic
925108919 2:1317008-1317030 TGGCCAGCATTGGAGAAGGTTGG + Intronic
925108927 2:1317052-1317074 AGGGCAGCATTGGAGAAGGTTGG + Intronic
925108963 2:1317272-1317294 AGGGCAGCATTGGAGAAGGTTGG + Intronic
929753850 2:44746792-44746814 TGGACTGCATTCCAGCAGAAAGG - Intronic
941463058 2:165793955-165793977 TGGGCTGCGTTAGAGCAGGCGGG - Intronic
942552838 2:177137728-177137750 TGGGCTGCATGCGGCCAGGATGG - Intergenic
946028997 2:216690632-216690654 TGGGCTGGATTTGAGCAGGCAGG - Intronic
1169691022 20:8332211-8332233 TGGGCTGCTTTCCAGCAGTGGGG + Intronic
1176237061 20:64058279-64058301 GGGGCTGCATTAGGGCACGTGGG - Intronic
1178502128 21:33134247-33134269 TGGGTGGCATTGGAGCAGGTGGG - Intergenic
1181625175 22:24118239-24118261 TGGGCTGCAGGGGAGCAGGGAGG + Intronic
953675393 3:44997567-44997589 TGGGCAGAATTTAAGCAGGTTGG + Intronic
957348015 3:78986524-78986546 TGGTCTGCATTTGATCAGCTTGG - Intronic
960925868 3:122794837-122794859 GAGGCTGTATTCGAGGAGGTTGG - Exonic
961533486 3:127554829-127554851 TGGGCTGCAGATGAGCAGATGGG - Intergenic
964638435 3:158882799-158882821 AGGGCTGCATTTGAGCATGGAGG + Intergenic
967515783 3:190366733-190366755 TGGGCTGCTTTCCAGGAGGGAGG + Intronic
968080567 3:195843592-195843614 CGGGCTGCACCCGAGCAGGGTGG + Intergenic
968332301 3:197881403-197881425 TGTGCTGCACACGAGCAGATGGG + Intronic
969584889 4:8085800-8085822 CAGGCTGAATTCCAGCAGGTGGG - Intronic
971058496 4:22940382-22940404 TGGGATGCATTGAAGTAGGTGGG - Intergenic
985216190 4:187656883-187656905 AGGGCTGCATTGAAGCAGGTGGG - Intergenic
987840993 5:23222667-23222689 TGGGCTGCATTGTGGCAGGTGGG + Intergenic
990350053 5:54907027-54907049 TGGGCTGCATGTGGGCGGGTTGG + Intergenic
997813221 5:136992489-136992511 TGGGCTGTGTTGGAGCTGGTGGG + Exonic
997889119 5:137659397-137659419 TGGGCAGCATTGGAGCTGGCAGG + Intronic
1005778102 6:29159960-29159982 TGCGCTGCATCCTAGCAGCTCGG - Intergenic
1005778759 6:29165919-29165941 TGCGCTGCATCCTAGCAGCTCGG + Intergenic
1007118625 6:39362277-39362299 GGGGCTGCCTTTGAGCAGGCAGG - Intronic
1011516194 6:88156439-88156461 TGGGCTGTATTCGAGGTGGAGGG - Intronic
1019729359 7:2622015-2622037 GGGGCTGCAGCTGAGCAGGTGGG + Intergenic
1021100711 7:16584425-16584447 TGGGCTGCATCATGGCAGGTGGG + Intergenic
1024993077 7:55251493-55251515 TGGACTGCATTCTTGCTGGTTGG + Intronic
1028286448 7:89008823-89008845 TGGGCTACATTCAAGGAGATGGG - Intronic
1037838859 8:22230273-22230295 TGGGCTGCCTCCGAGCGTGTGGG - Intronic
1041030260 8:53729443-53729465 TGGGCTGCTTTCTTGCACGTTGG - Intronic
1041552058 8:59113972-59113994 TGGGCTCCATTCAAGAGGGTTGG - Intronic
1049573538 8:143380360-143380382 TGGGCAGCCTCTGAGCAGGTGGG + Intronic
1056396580 9:86186837-86186859 TGGGCTGCATGGGGGCAGGGTGG + Intergenic
1056525687 9:87440985-87441007 TGGGCATTATTCGATCAGGTAGG - Intergenic
1057388247 9:94622876-94622898 GGAGCTGCATTTGAGCTGGTGGG - Intronic
1060423479 9:123486042-123486064 TGGGGTGCATGGGAGCAGGTGGG + Intronic
1060492920 9:124098159-124098181 TTGGCTGCATTCAAGGAGATGGG - Intergenic
1062045037 9:134421052-134421074 TGGGCAGCACTGGAGCAGGGTGG - Intronic
1062207838 9:135347010-135347032 GAGGGTGCATTGGAGCAGGTGGG - Intergenic
1062245340 9:135563196-135563218 GAGGCTGCAGGCGAGCAGGTGGG + Intronic
1200215318 X:154365676-154365698 TGGGCTGGTGTGGAGCAGGTGGG - Intronic