ID: 1135215234

View in Genome Browser
Species Human (GRCh38)
Location 16:20560545-20560567
Sequence TGTACACTGTGCAGAACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135215229_1135215234 7 Left 1135215229 16:20560515-20560537 CCCATCAGAAGCAGATGCCAGCA 0: 4
1: 5
2: 15
3: 46
4: 301
Right 1135215234 16:20560545-20560567 TGTACACTGTGCAGAACTTTGGG No data
1135215231_1135215234 -10 Left 1135215231 16:20560532-20560554 CCAGCACACTTCCTGTACACTGT 0: 1
1: 0
2: 2
3: 16
4: 173
Right 1135215234 16:20560545-20560567 TGTACACTGTGCAGAACTTTGGG No data
1135215227_1135215234 9 Left 1135215227 16:20560513-20560535 CCCCCATCAGAAGCAGATGCCAG No data
Right 1135215234 16:20560545-20560567 TGTACACTGTGCAGAACTTTGGG No data
1135215230_1135215234 6 Left 1135215230 16:20560516-20560538 CCATCAGAAGCAGATGCCAGCAC 0: 3
1: 7
2: 12
3: 47
4: 288
Right 1135215234 16:20560545-20560567 TGTACACTGTGCAGAACTTTGGG No data
1135215228_1135215234 8 Left 1135215228 16:20560514-20560536 CCCCATCAGAAGCAGATGCCAGC 0: 14
1: 140
2: 335
3: 812
4: 1473
Right 1135215234 16:20560545-20560567 TGTACACTGTGCAGAACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135215234 Original CRISPR TGTACACTGTGCAGAACTTT GGG Intronic
No off target data available for this crispr