ID: 1135217307

View in Genome Browser
Species Human (GRCh38)
Location 16:20583907-20583929
Sequence CACATTGCACAATAGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135217303_1135217307 1 Left 1135217303 16:20583883-20583905 CCAAAAGTTGTTGCTGTGATTTA No data
Right 1135217307 16:20583907-20583929 CACATTGCACAATAGGAGGTTGG No data
1135217301_1135217307 20 Left 1135217301 16:20583864-20583886 CCCTCTAAAAAGAAAAAAACCAA No data
Right 1135217307 16:20583907-20583929 CACATTGCACAATAGGAGGTTGG No data
1135217302_1135217307 19 Left 1135217302 16:20583865-20583887 CCTCTAAAAAGAAAAAAACCAAA No data
Right 1135217307 16:20583907-20583929 CACATTGCACAATAGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135217307 Original CRISPR CACATTGCACAATAGGAGGT TGG Intergenic
No off target data available for this crispr