ID: 1135220149

View in Genome Browser
Species Human (GRCh38)
Location 16:20607389-20607411
Sequence TGCCTTTGAAGTATTGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135220149_1135220150 -3 Left 1135220149 16:20607389-20607411 CCAGGCTCAATACTTCAAAGGCA No data
Right 1135220150 16:20607409-20607431 GCAATCCCTCAAAAAGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135220149 Original CRISPR TGCCTTTGAAGTATTGAGCC TGG (reversed) Intergenic
No off target data available for this crispr