ID: 1135222623

View in Genome Browser
Species Human (GRCh38)
Location 16:20625740-20625762
Sequence CTGCCTGTACTGATGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135222618_1135222623 -6 Left 1135222618 16:20625723-20625745 CCCGGCTTCTTGCCTCACTGCCT No data
Right 1135222623 16:20625740-20625762 CTGCCTGTACTGATGGAGGACGG No data
1135222619_1135222623 -7 Left 1135222619 16:20625724-20625746 CCGGCTTCTTGCCTCACTGCCTG No data
Right 1135222623 16:20625740-20625762 CTGCCTGTACTGATGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135222623 Original CRISPR CTGCCTGTACTGATGGAGGA CGG Intronic
No off target data available for this crispr