ID: 1135231196

View in Genome Browser
Species Human (GRCh38)
Location 16:20709666-20709688
Sequence CTGTATAAGGATAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135231196_1135231200 -2 Left 1135231196 16:20709666-20709688 CCCACTTCCTTATCCTTATACAG 0: 1
1: 0
2: 0
3: 20
4: 220
Right 1135231200 16:20709687-20709709 AGTTATTCACTTTCTCAAGAAGG No data
1135231196_1135231201 -1 Left 1135231196 16:20709666-20709688 CCCACTTCCTTATCCTTATACAG 0: 1
1: 0
2: 0
3: 20
4: 220
Right 1135231201 16:20709688-20709710 GTTATTCACTTTCTCAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135231196 Original CRISPR CTGTATAAGGATAAGGAAGT GGG (reversed) Intronic
903165409 1:21516843-21516865 CTGTATAAGGATTAGGTCATGGG - Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904351143 1:29907463-29907485 CTGAAAAAAGGTAAGGAAGTTGG - Intergenic
905168319 1:36096505-36096527 CTTATTAAGGAAAAGGAAGTGGG + Exonic
905252861 1:36660743-36660765 TTGTTTAAGGATAAGGTACTGGG + Intergenic
906443928 1:45876782-45876804 TTGTATAGGTGTAAGGAAGTCGG + Intronic
907191676 1:52654342-52654364 CTGAAAAAGAATAATGAAGTTGG + Intronic
907622242 1:55993161-55993183 GTGTATAAGGATAAATAAATAGG - Intergenic
908279159 1:62512427-62512449 ATTTATAAGGAAAAGGAAGATGG + Intronic
908901107 1:68957573-68957595 CTGTCTATGAACAAGGAAGTAGG + Intergenic
909129258 1:71714514-71714536 CTGTACAATGAAAAGCAAGTTGG + Intronic
910160119 1:84263427-84263449 AGGTAAAAGGATAAGGAAGAAGG + Intergenic
911366898 1:96949510-96949532 CTGTCTATGAATCAGGAAGTGGG - Intergenic
912197773 1:107419654-107419676 CTGTATATAGCTAAGGAAGGTGG - Intronic
912318031 1:108683844-108683866 CTGCATAAGGCTCAGGAATTGGG - Intergenic
912583817 1:110743577-110743599 CTGTACTAATATAAGGAAGTGGG + Intergenic
912769273 1:112448056-112448078 GAGTATAAGGATCAGGAAGTGGG - Intronic
913025855 1:114839372-114839394 CTGAAAAAGTATAAGGCAGTAGG + Intergenic
914977256 1:152378054-152378076 CTGTCTTATGATAAGGAAGGGGG - Intergenic
915697444 1:157758244-157758266 CTGTAAAAGAATGAGGAACTGGG + Intronic
916778488 1:167996007-167996029 CTGTATAAGTAGAACAAAGTAGG + Intronic
917690011 1:177459184-177459206 CTGTCTCAGGACAAGAAAGTTGG + Intergenic
918188459 1:182148444-182148466 CAGTAATAGGAGAAGGAAGTAGG - Intergenic
918659268 1:187069882-187069904 CAGAATATGGATAAAGAAGTAGG + Intergenic
920008816 1:202853034-202853056 CTGGAGAAGGATTATGAAGTAGG - Intergenic
920098823 1:203503794-203503816 CCGTTTAAAGATAAGGAATTGGG - Intronic
922610748 1:226925229-226925251 CTGTATACTCACAAGGAAGTGGG + Intronic
924261510 1:242236147-242236169 CTGTCTATGAACAAGGAAGTGGG + Intronic
1064621624 10:17223355-17223377 TTGTATAAGGATTAGAAAGCAGG - Intergenic
1064964602 10:21002366-21002388 CTTTATAAGGTTTAGGTAGTAGG - Intronic
1065611905 10:27480081-27480103 CTGCTTAAAGAAAAGGAAGTAGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066705839 10:38176457-38176479 CTGTTCAAAGATAAGAAAGTTGG + Intergenic
1072652198 10:97304452-97304474 CTCTATAGTGATTAGGAAGTAGG + Intergenic
1072820225 10:98549517-98549539 CTGTAGCAGGATAAGGAAATAGG - Intronic
1073890444 10:108095471-108095493 CTTTAAAAGCATAAGGAAATTGG - Intergenic
1073994186 10:109296305-109296327 CAGTTTATGGATAAGGAAATGGG - Intergenic
1075568931 10:123524888-123524910 TTAAAAAAGGATAAGGAAGTAGG - Intergenic
1080417564 11:32083158-32083180 CGGCAAAAGGATAAGGAAGTAGG - Intronic
1082183974 11:49156794-49156816 CTCTAAAAGGATAAGCAAATTGG - Exonic
1085468188 11:76738283-76738305 CTGAACAGGGATAGGGAAGTGGG + Intergenic
1085995809 11:81912268-81912290 CTGTATAATAATAAGAAGGTAGG - Intergenic
1086185846 11:84014812-84014834 CTGTATCAGGATTAGGATGTAGG - Intronic
1086597320 11:88588543-88588565 CTGTATATGGGTAAGCAGGTAGG - Intronic
1086682381 11:89688575-89688597 CTCTAAAAGGATAAGCAAATTGG + Intergenic
1089778844 11:120858914-120858936 CTGTGGAAGGACAAGGAAGGGGG - Intronic
1090174121 11:124632664-124632686 CTGTCTAAGAACTAGGAAGTGGG - Exonic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1096076714 12:48810538-48810560 CTGAATAAGGTTGAGGAAGTGGG - Intergenic
1098185683 12:67893593-67893615 CTGGATAATGATTAGGAAGTTGG - Intergenic
1100115710 12:91301268-91301290 TTGTATAAGTGTAAGGAAGGGGG - Intergenic
1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG + Exonic
1101952515 12:109187759-109187781 CTGTAAAAAAATAACGAAGTTGG - Intronic
1105502394 13:20983809-20983831 GTGTAGAAGGAAAAGGAAGGAGG + Intronic
1105687373 13:22797883-22797905 CTCTTTAAGGATAAGGAGCTTGG + Intergenic
1105690383 13:22831608-22831630 CTGAATGAGGATAAGGAGTTTGG - Intergenic
1106364725 13:29067373-29067395 GTGTATGAGGCTAAGGAAGAGGG + Intronic
1107934977 13:45338641-45338663 ATGTGTAAGTACAAGGAAGTGGG - Exonic
1109176628 13:59165940-59165962 CATTAAAAGGATAAGTAAGTAGG + Intergenic
1111915001 13:94351564-94351586 GTTTATGAGAATAAGGAAGTAGG - Intronic
1112425212 13:99292003-99292025 CTATTTAAGGATTATGAAGTCGG + Intronic
1113176039 13:107565023-107565045 CTGTATAAACACAAAGAAGTAGG + Intronic
1114234139 14:20810111-20810133 CTTTAGAAGAATAAGGAAGTGGG + Intergenic
1117238679 14:53805492-53805514 GTTTATAAGGATAAGTAAGATGG - Intergenic
1117983673 14:61366602-61366624 GTGTATAAGGAAATGGATGTCGG + Intronic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1122496349 14:102158637-102158659 AAGAATAAGGATAGGGAAGTAGG - Intronic
1127269997 15:57391839-57391861 CTGAATAAGGATATGGAATAAGG - Intronic
1129653457 15:77507525-77507547 CAGTAGAGGGACAAGGAAGTGGG + Intergenic
1130263672 15:82379623-82379645 CTTTATATGGCTTAGGAAGTGGG + Intergenic
1130277619 15:82490022-82490044 CTTTATATGGCTTAGGAAGTGGG - Intergenic
1130469944 15:84217211-84217233 CTTTATATGGCTTAGGAAGTGGG - Intergenic
1130477432 15:84331774-84331796 CTTTATATGGCTTAGGAAGTGGG - Intergenic
1130494333 15:84456356-84456378 CTTTATATGGCTTAGGAAGTGGG + Intergenic
1130592233 15:85221835-85221857 CTTTATATGGCTTAGGAAGTGGG - Intergenic
1130775022 15:86969975-86969997 CCTTATAACTATAAGGAAGTTGG + Intronic
1130875928 15:88014343-88014365 CTGCATAAGGATTTGGAAGAAGG - Intronic
1131000508 15:88936322-88936344 TTGTTTGAGGATAAAGAAGTTGG - Intergenic
1131656561 15:94466545-94466567 CAGGATAAGAATAAGGAAGGAGG - Intronic
1131994572 15:98121794-98121816 CTGTAGGAGGAAAAGGAAGCTGG - Intergenic
1133122355 16:3617634-3617656 GTGCATAAGGATAAGGATGGAGG + Intronic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1135976179 16:27110079-27110101 CTGAAAAAGGATAACGAGGTGGG + Intergenic
1140279571 16:73542378-73542400 TTGTATAAAAATAAGGACGTTGG - Intergenic
1141643053 16:85352629-85352651 CCTTAGAAGGATAAGGAAGGGGG + Intergenic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1153479565 18:5533805-5533827 ATTTAAAAGGTTAAGGAAGTAGG - Intronic
1155723946 18:29055238-29055260 CTGTAAAAAGATAAGGAAGGGGG + Intergenic
1156061090 18:33077170-33077192 CTGTATATGGATAATGAGTTGGG + Intronic
1157788113 18:50505116-50505138 CTTTATCAGAATAAGCAAGTGGG - Intergenic
1159670811 18:71218534-71218556 CTGTAACTGGATAAGTAAGTTGG + Intergenic
1160611557 18:80091766-80091788 CTTTATGACGTTAAGGAAGTTGG - Intronic
925202843 2:1982791-1982813 CTGGATAAGGGTAAGCAAGCTGG - Intronic
927893484 2:26766800-26766822 CTGTATAAGGAAACTGAGGTAGG + Intronic
930885896 2:56326007-56326029 AAGTATAATGATAAGGAAGAGGG + Intronic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
936659221 2:114523608-114523630 CTGTAGAGGGAAAAGGAAGTGGG + Intronic
936669062 2:114634337-114634359 CTGTATAAGGATAGGGACTTGGG - Intronic
939024128 2:136991671-136991693 CTGTATATTTATAAGGCAGTAGG + Intronic
939648260 2:144729099-144729121 CTGAAGAAGGATAATGAACTAGG - Intergenic
939977303 2:148733179-148733201 CTGTATATGGATGATGAAGCTGG + Intronic
940461877 2:153974836-153974858 ATGTGTAAGGAAAAGAAAGTTGG + Intronic
940931646 2:159439213-159439235 CTGGATAACGACAAGGTAGTTGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
944098342 2:195994933-195994955 CTGTCTAAAGAAAAGGAAGAAGG - Intronic
945537605 2:211038253-211038275 CTATATAAGGATAGTGAAGCTGG + Intergenic
945808437 2:214518610-214518632 CTGTTGAAGGACAAGGAAGGGGG - Intronic
1169962684 20:11179302-11179324 ATGTATAAGGATAGTCAAGTTGG - Intergenic
1170417394 20:16159075-16159097 CTGTAGGGGGAGAAGGAAGTGGG - Intergenic
1172168395 20:32913274-32913296 CTGTCTATGAATCAGGAAGTAGG - Intronic
1175671940 20:60910806-60910828 CTGTATAAAAAGAAGAAAGTTGG - Intergenic
1178490854 21:33050611-33050633 CTCCATAAGGAGAAGGAAGGAGG - Intergenic
1178513161 21:33224326-33224348 TTATATAATGATAAGAAAGTCGG - Intergenic
1179606197 21:42517048-42517070 CTGGACAAGGAGATGGAAGTAGG + Intronic
1184553480 22:45218691-45218713 CAGGCTAAGGATAAGGATGTGGG - Intronic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
951131766 3:19055103-19055125 CTGAATAAGAGTAAGGAATTTGG - Intergenic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
953764385 3:45725127-45725149 TTGCAAAAGGAGAAGGAAGTTGG - Intronic
957748920 3:84386145-84386167 CCTGATAAGAATAAGGAAGTAGG + Intergenic
958118509 3:89254642-89254664 CGTTATAAGGATAAGGGAGTGGG - Intronic
958595175 3:96213306-96213328 GTGTATAATAATATGGAAGTAGG + Intergenic
959769443 3:110074849-110074871 TTGAAGAAGGATAAGGAAATGGG - Intergenic
960937279 3:122911847-122911869 CTTCAGAAGGAGAAGGAAGTTGG + Intronic
961821706 3:129578635-129578657 CTGTTTAAAGATGAGGAAGGTGG + Intronic
962100588 3:132338172-132338194 TTGTATATGCATAAGGAAATTGG - Intronic
964918780 3:161870601-161870623 CTGTATTAGGATAAGGTAGAAGG - Intergenic
965402321 3:168226642-168226664 CTATATAAGGATGAGAAAATAGG - Intergenic
966377249 3:179308953-179308975 CTGCATAAGGATTAGGAATTGGG - Intergenic
966555448 3:181254417-181254439 GTGTATAAAGATATGGAAGAAGG + Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968262878 3:197339315-197339337 CAGTTTAAAGGTAAGGAAGTGGG - Intergenic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
971112603 4:23605842-23605864 CTGTCTATGCATCAGGAAGTGGG - Intergenic
971152194 4:24045070-24045092 CTGTGTAAGAATTAGGATGTAGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972915144 4:43867791-43867813 CTGTCTTATGATAATGAAGTAGG - Intergenic
973963663 4:56137923-56137945 AAGGGTAAGGATAAGGAAGTGGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976224897 4:82788129-82788151 CCATATATGAATAAGGAAGTGGG + Intronic
978128982 4:105170942-105170964 GTGTAGAAGGAGGAGGAAGTTGG - Intronic
978453877 4:108866500-108866522 CTCTATCAGGCTAAGGAAATAGG - Intronic
980181825 4:129410638-129410660 CTTTATAAGGCAAAGGAAGAAGG - Intergenic
982764250 4:159325806-159325828 CTGGAAAAGGAAGAGGAAGTAGG + Intronic
983975533 4:173929202-173929224 CTGCATAAGGAGAAAGAAGGTGG - Intergenic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
986093665 5:4535471-4535493 CTGTATATGAACCAGGAAGTTGG + Intergenic
986510400 5:8500313-8500335 CTTTATAAGGAGAAGAAATTTGG + Intergenic
991642337 5:68767668-68767690 GTGTGTAAGGATTAGGAAGAGGG - Intergenic
991895700 5:71395701-71395723 CTGTATAAAGATTAGGGTGTGGG - Intergenic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
994269968 5:97765126-97765148 CTGAATAAGGATAAGCAACAAGG - Intergenic
994923237 5:106079927-106079949 CTGGATAAGAATGAGGTAGTTGG + Intergenic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
997754369 5:136382341-136382363 CTGTCTAAGGTTTAGGAAATGGG + Intronic
998677619 5:144427186-144427208 ATGTTTCAGGATAAAGAAGTTGG + Intronic
999103028 5:149043118-149043140 CTGTATTAGAAAAAGGCAGTTGG - Intronic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
1004064872 6:12234072-12234094 CTGTATCAGGGTTAGGAAGTTGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004749876 6:18551363-18551385 CTGTAAAAGGAAAAGTAATTGGG + Intergenic
1006886884 6:37389457-37389479 CTGTATTTGGAGGAGGAAGTAGG + Intronic
1007020236 6:38512438-38512460 CTATTTAAGAATAAGGATGTGGG + Intronic
1010672999 6:78709063-78709085 CTGTCTATGAATGAGGAAGTGGG - Intergenic
1011048472 6:83114942-83114964 CTGAATAAGGATTATGACGTAGG + Intronic
1012704473 6:102503686-102503708 CTATAAATGGATATGGAAGTAGG - Intergenic
1013490036 6:110637429-110637451 GTGTTTAAAGAAAAGGAAGTTGG + Intronic
1015203779 6:130612427-130612449 CTGAATAGGGACAAGGAAGTTGG + Intergenic
1015771461 6:136772402-136772424 CTGTATACAGATAAGGCAGAAGG + Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1018496456 6:164351335-164351357 ATGTTCAAGAATAAGGAAGTAGG + Intergenic
1018914406 6:168124044-168124066 ATGTATCAGTATAAGTAAGTGGG - Intergenic
1023148237 7:37174197-37174219 CTTTATAGGAAAAAGGAAGTGGG - Intronic
1023500184 7:40840937-40840959 CTATAAAAGGATTAGGTAGTTGG - Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023753772 7:43396842-43396864 CCGTCCAAGGACAAGGAAGTCGG + Exonic
1024019645 7:45354708-45354730 ACGTATAAGGAAAAGGATGTTGG + Intergenic
1024033692 7:45487951-45487973 CTGTAAAAAGATTAGGTAGTTGG + Intergenic
1024400523 7:48919583-48919605 CTGTATAAGAATACTGGAGTAGG - Intergenic
1025061309 7:55810941-55810963 CTGTACAAGGAAAAGGCAGAAGG - Intronic
1025815235 7:64904622-64904644 GTGAATTAGGATGAGGAAGTTGG - Intronic
1025974272 7:66357213-66357235 CTGTTTACTGATAAGGAAGCTGG + Intronic
1026864004 7:73811328-73811350 CTGTATATGGCTAAGGCTGTGGG - Intronic
1028399037 7:90404668-90404690 CGGTGAAAGGATAAGGAAGGTGG - Intronic
1031252076 7:119397310-119397332 CTGTAAAAGGCTCAGGAAGTGGG - Intergenic
1031471112 7:122170301-122170323 CTGTAGGAGGACAAGGAAGGCGG - Intergenic
1031774187 7:125885710-125885732 CTGTCTCTGAATAAGGAAGTAGG + Intergenic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1035893951 8:3376001-3376023 GTGGATGAGGATAAAGAAGTTGG - Intronic
1036954344 8:13171379-13171401 CTAAATAAGTAAAAGGAAGTAGG - Intronic
1038208171 8:25489186-25489208 CTGGAGAAGGAAAAGGAACTGGG - Intronic
1038541827 8:28396186-28396208 CTATAGAAGGATAAGGAAGAAGG - Intronic
1039503948 8:38038092-38038114 CTGTATGAGGATAAGTAGGAGGG - Intronic
1039599036 8:38818290-38818312 CTGGATTAGGATTAGGAAGTAGG + Intronic
1040681451 8:49815374-49815396 CTGTCTCAGTATAAGGAATTTGG - Intergenic
1040918122 8:52584849-52584871 TTGAATAAATATAAGGAAGTAGG - Intergenic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1042940312 8:74100643-74100665 CAGGAGAAAGATAAGGAAGTGGG - Intergenic
1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG + Intergenic
1044490345 8:92806073-92806095 CATTACAAAGATAAGGAAGTGGG - Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044902768 8:96966367-96966389 ATGAATAAGGGAAAGGAAGTAGG - Intronic
1045099995 8:98834608-98834630 CTGTCTATGAATCAGGAAGTTGG - Intronic
1045100203 8:98836302-98836324 CTGTCTATGAATCAGGAAGTTGG - Intronic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1048937054 8:139366128-139366150 CTGTTTAGAGATAAGGAAGCAGG - Intergenic
1049451225 8:142662914-142662936 CTTTAGAAGGATGAGGAAGGAGG + Intronic
1050214069 9:3302139-3302161 CTGTATTAAAATATGGAAGTAGG + Intronic
1050695306 9:8272907-8272929 CTTTATCAGGTTGAGGAAGTTGG + Intergenic
1052141143 9:24986088-24986110 TTGTATAAGCATAGGCAAGTTGG + Intergenic
1052959731 9:34285256-34285278 CTGGAAAAGGAAATGGAAGTGGG + Intronic
1055243812 9:74217306-74217328 CTGTTAAATGATACGGAAGTGGG + Intergenic
1055756337 9:79562467-79562489 CTTTATAAGGTTAAGAAATTTGG - Intergenic
1057597540 9:96428049-96428071 CAGTTAAAGGATCAGGAAGTGGG + Intergenic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186096006 X:6102476-6102498 CTGTCTATGAATCAGGAAGTGGG + Intronic
1186502885 X:10066184-10066206 CTGTATCAGGCTAAGGAGATTGG + Intronic
1186568489 X:10689768-10689790 ATGTGTAAGGAGAAGGAAATTGG - Intronic
1186979457 X:14943590-14943612 CTATAAAAGGAAAAGTAAGTTGG + Intergenic
1187013165 X:15300487-15300509 GTGTATAAGAGTAAAGAAGTAGG + Intronic
1188836551 X:34963602-34963624 CTGTTTACTGATAAGGAATTAGG - Intergenic
1189386340 X:40539811-40539833 CTGTAGGAGGAGGAGGAAGTGGG - Intergenic
1193426575 X:81347377-81347399 CCTTATAAGGGTAAGGAAGAGGG - Intergenic
1193872981 X:86824289-86824311 CTGTAAACGGATGTGGAAGTAGG - Intronic
1194802855 X:98293359-98293381 CTGTATATGGATCAGGAATATGG - Intergenic
1196676870 X:118429286-118429308 TAATATAAGGATAAGGAAATAGG + Intronic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1199966551 X:152825105-152825127 CTGTAAAGGGATCAGGAAGATGG - Intergenic
1199966565 X:152825170-152825192 CTGTAAAGGGATCAGGAAGATGG - Intergenic
1201502693 Y:14662521-14662543 CTGTCTATGGACAACGAAGTGGG - Intronic
1201782724 Y:17741265-17741287 CTGTATAATGAGAATTAAGTTGG + Intergenic
1201818829 Y:18164723-18164745 CTGTATAATGAGAATTAAGTTGG - Intergenic