ID: 1135238810

View in Genome Browser
Species Human (GRCh38)
Location 16:20784296-20784318
Sequence CTAGTGTTCAATATCCATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135238808_1135238810 0 Left 1135238808 16:20784273-20784295 CCTCAGTTATACTAGTCCTGTTT No data
Right 1135238810 16:20784296-20784318 CTAGTGTTCAATATCCATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135238810 Original CRISPR CTAGTGTTCAATATCCATAT AGG Intronic
No off target data available for this crispr