ID: 1135243441

View in Genome Browser
Species Human (GRCh38)
Location 16:20831900-20831922
Sequence TGTTACATGAATATGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135243441_1135243446 5 Left 1135243441 16:20831900-20831922 CCCTTCCCCATATTCATGTAACA No data
Right 1135243446 16:20831928-20831950 AGTAGCTGATAACAGATTGCCGG No data
1135243441_1135243447 11 Left 1135243441 16:20831900-20831922 CCCTTCCCCATATTCATGTAACA No data
Right 1135243447 16:20831934-20831956 TGATAACAGATTGCCGGTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135243441 Original CRISPR TGTTACATGAATATGGGGAA GGG (reversed) Intronic
No off target data available for this crispr