ID: 1135245710

View in Genome Browser
Species Human (GRCh38)
Location 16:20855268-20855290
Sequence ATATGACTAGGTTTTAAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135245710_1135245720 30 Left 1135245710 16:20855268-20855290 CCCCCTTTAAAACCTAGTCATAT 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1135245720 16:20855321-20855343 CACAGACGGAGCTGGGGACCAGG 0: 1
1: 0
2: 1
3: 28
4: 278
1135245710_1135245718 23 Left 1135245710 16:20855268-20855290 CCCCCTTTAAAACCTAGTCATAT 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1135245710_1135245719 24 Left 1135245710 16:20855268-20855290 CCCCCTTTAAAACCTAGTCATAT 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1135245719 16:20855315-20855337 ATTAAGCACAGACGGAGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1135245710_1135245716 16 Left 1135245710 16:20855268-20855290 CCCCCTTTAAAACCTAGTCATAT 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1135245716 16:20855307-20855329 TAAGAGCAATTAAGCACAGACGG 0: 1
1: 0
2: 2
3: 12
4: 224
1135245710_1135245717 22 Left 1135245710 16:20855268-20855290 CCCCCTTTAAAACCTAGTCATAT 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1135245717 16:20855313-20855335 CAATTAAGCACAGACGGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 83
1135245710_1135245715 -7 Left 1135245710 16:20855268-20855290 CCCCCTTTAAAACCTAGTCATAT 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1135245715 16:20855284-20855306 GTCATATTCATTAGTGCAACAGG 0: 1
1: 0
2: 0
3: 4
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135245710 Original CRISPR ATATGACTAGGTTTTAAAGG GGG (reversed) Exonic
900749533 1:4386218-4386240 ATATCTGAAGGTTTTAAAGGTGG + Intergenic
907507262 1:54928833-54928855 ATATGGAGAGGTTTTAAAGAAGG + Intergenic
909297759 1:73972548-73972570 AAATGTCATGGTTTTAAAGGTGG + Intergenic
909473589 1:76057005-76057027 ATATTACTGGGCTTCAAAGGAGG - Intergenic
910950678 1:92644559-92644581 ATATGTCTAGTTTATTAAGGTGG + Intronic
911950754 1:104171225-104171247 AAATGGATAGGTTTTAAGGGAGG + Intergenic
912825520 1:112899617-112899639 ATTTGACTAGGGCATAAAGGTGG + Intergenic
913455653 1:119027964-119027986 ATATGACTACAATTTAGAGGAGG - Intergenic
915332289 1:155120583-155120605 ATTTGACTAGGCTTTAAAAAGGG + Intergenic
916151248 1:161793666-161793688 ATATGACTAGCGTATAAAGCAGG + Intronic
916208772 1:162341317-162341339 ATATAACTGTATTTTAAAGGGGG + Intronic
917765456 1:178211685-178211707 ATTTTCCTAGGTTTTACAGGAGG - Intronic
919350470 1:196446721-196446743 AGTTCACTAGGTTTTAAATGTGG - Intronic
920027761 1:203013334-203013356 CTATGACTAGGTTTGAAATAAGG + Intronic
921266858 1:213428173-213428195 ATATAACTTGGTTTGAAAGGAGG - Intergenic
1063883397 10:10553423-10553445 AGGTGATTAGGTTTTAAATGAGG - Intergenic
1064324326 10:14334522-14334544 ATTTGAGGAGTTTTTAAAGGAGG - Intronic
1064667069 10:17665068-17665090 ATATTCTTAGGTTTTAAAGGGGG + Intronic
1065768160 10:29051543-29051565 ATTTGAGTAAGTCTTAAAGGTGG + Intergenic
1065985181 10:30943808-30943830 AAAAATCTAGGTTTTAAAGGAGG - Intronic
1068812591 10:61273325-61273347 ATATGACTATGTTTTAAATGAGG + Intergenic
1068944614 10:62717254-62717276 GTATGACTACATTTTAAGGGTGG - Intergenic
1072233581 10:93433870-93433892 ATAGGACTAGATTTTAACGCTGG + Intronic
1073990088 10:109252755-109252777 ATATGAATAGGTTTTCTAGTTGG - Intergenic
1074223139 10:111458272-111458294 AAGTGATTAGGTCTTAAAGGGGG + Intergenic
1083020223 11:59499360-59499382 ATATGTTTAGGTTTTATAGCTGG + Intergenic
1085379738 11:76104138-76104160 ATATGACAAAGTTTAAAAGGTGG - Intronic
1085836293 11:79960568-79960590 ATATTATTAGCTTCTAAAGGAGG - Intergenic
1086192366 11:84094713-84094735 AGATGATTAGGTTTTGAAGGTGG - Intronic
1088272980 11:108054247-108054269 ATATGACTAGGTTGTCTAAGTGG - Intronic
1088618191 11:111654857-111654879 ATGTGACTATGTTTTAAATGAGG + Intronic
1089846423 11:121462214-121462236 AGATCTCCAGGTTTTAAAGGTGG - Intronic
1091605427 12:1947683-1947705 CTATGAATAGCTTTAAAAGGTGG + Intronic
1093640593 12:21523168-21523190 ACATGACTAGGTCATAAGGGTGG + Intergenic
1094563202 12:31575426-31575448 ATGTGACTTGCTTTTGAAGGGGG - Intronic
1096191817 12:49624266-49624288 AAATGAATAGGTTTTTGAGGAGG + Intronic
1096222110 12:49837107-49837129 ATAGGACTAGGTTTTGAATGAGG + Exonic
1099664430 12:85609508-85609530 ATATGACTATGTTTGGAAGTAGG - Intergenic
1101889404 12:108699008-108699030 ATATGAGTTTGTTTTAGAGGAGG - Intronic
1106904700 13:34392861-34392883 ATATGAATACTTTTTGAAGGAGG + Intergenic
1107285427 13:38784937-38784959 ATATGATTAGGTTTCAAAGTTGG + Intronic
1109150397 13:58840392-58840414 ATATGCATAAGTTTTAAAGCAGG - Intergenic
1111487350 13:88920956-88920978 ATGTGAATAGATTTAAAAGGTGG - Intergenic
1113409056 13:110068064-110068086 AGATGACTGGGTCTTAAGGGTGG - Intergenic
1115111915 14:29834056-29834078 ATATAATTACTTTTTAAAGGAGG - Intronic
1115332281 14:32211298-32211320 ATATTCCTGGGTTGTAAAGGTGG + Intergenic
1115914230 14:38292547-38292569 ATATAACGGTGTTTTAAAGGTGG + Intergenic
1117796252 14:59397282-59397304 ATATGACTATATTTGAAGGGAGG - Intergenic
1120298616 14:82677485-82677507 ATTTTACTGAGTTTTAAAGGTGG - Intergenic
1120325022 14:83013322-83013344 ATATGATGAGATTTTACAGGAGG - Intergenic
1120361488 14:83509206-83509228 ATATAACTAGATTTGAAAGGAGG - Intergenic
1120541889 14:85761230-85761252 ATATTACTTGGGTTTAAAGCAGG - Intergenic
1121160277 14:91732353-91732375 ATATAATAAGGTTTAAAAGGAGG + Intronic
1121608129 14:95256268-95256290 ATAGAACTGGGTTTTAAAGGAGG - Intronic
1125493007 15:40162405-40162427 ATCTGACTTGGGTTTAAATGGGG + Intronic
1130687958 15:86055696-86055718 AAATGACTAGGTTGTCAAGTGGG + Intergenic
1132266449 15:100476248-100476270 ATATAAATAGGTATAAAAGGAGG - Intronic
1133251421 16:4484276-4484298 ATATGCCCAAATTTTAAAGGAGG + Intronic
1135245710 16:20855268-20855290 ATATGACTAGGTTTTAAAGGGGG - Exonic
1135709923 16:24707602-24707624 ATATGAATAGTTTTTAAATTGGG + Intergenic
1138346258 16:56322131-56322153 AGGTGATTAGGTCTTAAAGGTGG - Intronic
1140348098 16:74234302-74234324 AGATGACTGGGTCTTGAAGGTGG + Intergenic
1145232988 17:21188480-21188502 ATAAAACCAGGTTTTAAAGCTGG + Intronic
1149488346 17:57063245-57063267 ATAGGACTAGGGTGTAAAGAAGG + Intergenic
1150850127 17:68696362-68696384 AAACGACTAAGTTTTGAAGGAGG + Intergenic
1151648827 17:75452835-75452857 AAATGACTAGGTTGAAAAGATGG + Intronic
1155922747 18:31619471-31619493 AAAAGACTAGGTTTTGAAGAGGG + Intergenic
1156468879 18:37364992-37365014 ATCTGGCTGGGTCTTAAAGGAGG + Intronic
1159168358 18:64730778-64730800 ACATGGCTAGGTTTTATATGTGG + Intergenic
1159428988 18:68326559-68326581 AGATGAGTAGTTTGTAAAGGAGG - Intergenic
1159710694 18:71755232-71755254 ATTTTTCTAGTTTTTAAAGGTGG - Intronic
1159740610 18:72164890-72164912 ATATGACAAAGTTATAAAGCTGG + Intergenic
925026296 2:609967-609989 ATCTGCACAGGTTTTAAAGGAGG - Intergenic
926905697 2:17803280-17803302 ATATGACTAAGTGTTAAGAGTGG - Intergenic
929227382 2:39524820-39524842 ATCTGACCATTTTTTAAAGGGGG - Intergenic
929693403 2:44093324-44093346 AGATGATTAGGTTGTAAAGAGGG + Intergenic
931988617 2:67766523-67766545 ACATGGTTAGGTGTTAAAGGTGG - Intergenic
932116352 2:69053078-69053100 ATATGACTTTATTTCAAAGGGGG + Intronic
933418114 2:82013366-82013388 ATATGTTTAATTTTTAAAGGTGG - Intergenic
933500530 2:83105262-83105284 AAATGACTAGGTTGTAAAGAAGG - Intergenic
933856775 2:86421634-86421656 ATATGCCTAAGTTTTTATGGAGG + Intergenic
933988179 2:87611433-87611455 ATATGGCTAGCTGTTAAATGAGG + Intergenic
935386771 2:102507729-102507751 CTTTGACTAGTTTTGAAAGGTGG + Intronic
935682896 2:105653062-105653084 ATAGGACTAGGTGTTGAAGGAGG + Intergenic
935833314 2:107023140-107023162 ATTTGACTATTTTTTTAAGGTGG - Intergenic
936305661 2:111339375-111339397 ATATGGCTAGCTGTTAAATGAGG - Intergenic
937455865 2:122041164-122041186 TTCTGACTAGGTTTTAAGGAAGG - Intergenic
939950719 2:148469171-148469193 ATGTGACCAGGTTTTACAGTTGG - Exonic
941255384 2:163223671-163223693 CTATGACTAGGATTCAAAGATGG + Intergenic
943101941 2:183497582-183497604 AGATGATTAGGTCATAAAGGTGG + Intergenic
944203657 2:197135076-197135098 ATTTTAGTAGGTTTTAAAAGGGG - Intronic
946615469 2:221504942-221504964 ATATGACTTGGGTATAATGGAGG + Intronic
946974261 2:225130610-225130632 ATATCACTAGGTTTAAAGGAAGG - Intergenic
1171142747 20:22757257-22757279 ATAAGACTGGGTTTGAATGGAGG + Intergenic
1175573925 20:60046212-60046234 TTATGTCTAGTTTTTAAAAGAGG - Intergenic
1178103395 21:29294324-29294346 AAACAACTAGGCTTTAAAGGTGG - Intronic
1178458304 21:32776667-32776689 ATGTGACTAGGTCACAAAGGTGG - Intergenic
1178943546 21:36927278-36927300 ACATGACTGGGTTTTATAGTGGG + Intronic
1181901994 22:26163784-26163806 ATGTGACTAACTTTTAAATGTGG - Intergenic
1183890671 22:40925444-40925466 GTATGACTAGGTTCAAAGGGTGG - Intronic
1184575990 22:45366498-45366520 ATATGACAAGGTTAAAGAGGGGG + Intronic
951187888 3:19735377-19735399 TTATGAGAAGGTTTGAAAGGAGG - Intergenic
951483313 3:23184641-23184663 AAATCACTAATTTTTAAAGGAGG - Intergenic
952269177 3:31815644-31815666 AGATGACTGGGTTCTAAATGAGG + Intronic
954048163 3:47951005-47951027 ATAAGACTAGTTTTTCAAGTAGG + Intronic
956341619 3:68231005-68231027 ATATGACTAGTGATTAAAGAAGG - Intronic
957118967 3:76063969-76063991 ATATGGCTAGGATCTGAAGGTGG + Intronic
958983497 3:100753263-100753285 ATATGACTTGTTATTAAAAGTGG + Intronic
959889595 3:111539825-111539847 ATATTACCAGGATTGAAAGGCGG + Intronic
961410218 3:126715025-126715047 ATTCGACTAGTTTTTAAAGTAGG + Intronic
963714910 3:148791860-148791882 GTAAGACTAGGTTTAAAAGAAGG + Intronic
964163247 3:153671257-153671279 ATATAACTAATTTTGAAAGGAGG + Intergenic
964330180 3:155593602-155593624 ATATGCCTATGATTTAAAAGAGG + Intronic
965212264 3:165807306-165807328 ATATGACTTGATTTTAAAAATGG - Intronic
966660028 3:182404209-182404231 ATAACAGTAGGTTTTAAAGCTGG - Intergenic
970811027 4:20094212-20094234 TTATGACTACGTTATAAAGTAGG + Intergenic
970894367 4:21085287-21085309 ATATGATTGGGTTTTCAATGAGG - Intronic
972404877 4:38736006-38736028 ATATGACTCAGGTTTAAGGGTGG + Intergenic
972426649 4:38939559-38939581 AAATGACTGGGTTTTTAAAGAGG + Intronic
972473576 4:39430363-39430385 AAATTACTAGGATTCAAAGGAGG - Intronic
972615577 4:40694872-40694894 ATATGCCTAATTTTAAAAGGGGG - Intergenic
974210090 4:58761443-58761465 ATACAACCAGGTTTTAGAGGTGG - Intergenic
974318172 4:60308856-60308878 ATTGGAATAGCTTTTAAAGGAGG - Intergenic
975788633 4:77923035-77923057 AAATGAATAGTTTTTAAAAGAGG + Intronic
978122164 4:105092630-105092652 ATGTGACTAAGTTTCAAAGAGGG - Intergenic
979066791 4:116147427-116147449 GTAGAACTAGGTTGTAAAGGTGG - Intergenic
979411764 4:120387898-120387920 ATTGAACTAGGCTTTAAAGGAGG + Intergenic
980417949 4:132518080-132518102 AAATGTCTAGGTTTTAAATATGG - Intergenic
980499933 4:133636542-133636564 ATATGACTAGGTTATAAAATGGG + Intergenic
982524094 4:156455949-156455971 ATATGACTTACTTTTAAAGAAGG - Intergenic
984197460 4:176676287-176676309 ATATGCCTAGGTTTTTCAGAAGG - Intergenic
987287815 5:16476338-16476360 ATATGAGCAGATTATAAAGGAGG - Intronic
988693520 5:33596179-33596201 AAGTTACTTGGTTTTAAAGGAGG + Intronic
990800181 5:59593257-59593279 ATATGAGTAAGTTTTGAAGTTGG - Intronic
990957057 5:61352239-61352261 CTATGATTAGGATTCAAAGGAGG - Intronic
992509643 5:77420363-77420385 ACATGAGTAGGTTTTAAAAAAGG - Intronic
992928185 5:81613321-81613343 ATTCGAGTAGATTTTAAAGGAGG - Intronic
1000967700 5:167679053-167679075 ATGTGATTAGGTTTTCAAGAGGG - Intronic
1000978972 5:167796172-167796194 ATATGACTAGATTAGATAGGAGG - Intronic
1000988239 5:167884348-167884370 AGATGAATATGTTTTAGAGGTGG - Intronic
1004371820 6:15059423-15059445 ATATGACTTGGTCATAAGGGTGG - Intergenic
1005072291 6:21873029-21873051 ATATGCTTAGCTTTGAAAGGTGG + Intergenic
1008435235 6:51468082-51468104 AAATTACCAGGTTTAAAAGGGGG - Intergenic
1013224676 6:108112203-108112225 ATATGAGGAGAGTTTAAAGGTGG + Intronic
1014783058 6:125586956-125586978 ATATGTCTAGGTTTTATGGCTGG + Intergenic
1014803076 6:125798895-125798917 ATATTAGTAGCTTTAAAAGGAGG - Intronic
1018273575 6:162106239-162106261 AAATTATTAGGTTTTCAAGGTGG + Intronic
1018304547 6:162441487-162441509 ATATTATGAAGTTTTAAAGGTGG - Intronic
1018876934 6:167828968-167828990 ATATGACTAGTTTTTAAAATTGG + Intronic
1019877990 7:3832387-3832409 TTATGACTAAGTGGTAAAGGTGG - Intronic
1022043899 7:26607929-26607951 ATATGACTACATATTAAAAGAGG + Intergenic
1026174209 7:67981737-67981759 AGATGACTAGGTCCTAAGGGTGG + Intergenic
1031077926 7:117230703-117230725 ATATGGAAAGCTTTTAAAGGTGG - Intergenic
1031190276 7:118540328-118540350 ATATTCCTAGGTTATAAAGCTGG + Intergenic
1032256421 7:130300672-130300694 AAATGTCAAGGTTTAAAAGGGGG - Intronic
1032428444 7:131840974-131840996 ATGAGACTAGTTTTAAAAGGTGG - Intergenic
1035099782 7:156387201-156387223 ATATGACTTTTTTTTAAAGAAGG + Intergenic
1042152553 8:65804057-65804079 ATATGACAAAGGTTTAAAAGGGG + Intronic
1042444350 8:68866819-68866841 ATAGAACTAGGTTTTAAATCAGG - Intergenic
1043309860 8:78844595-78844617 ATATAACTAGATTTAAAAGAAGG + Intergenic
1043660379 8:82733516-82733538 ATATGGCTAGCTTTTAAAAAAGG - Intergenic
1045761561 8:105614412-105614434 ATATGACTAAGATTTTAGGGAGG - Intronic
1047058452 8:121194174-121194196 ATATTACTCGCTTTTAAAGTGGG + Intergenic
1052212870 9:25928262-25928284 ATATGACTGGTTTTTAAATGCGG + Intergenic
1052397105 9:27951600-27951622 AAATGAGTATGTTTTAAATGTGG + Intronic
1052620591 9:30903905-30903927 ATTTGACTAGATTATAATGGTGG - Intergenic
1056029955 9:82543084-82543106 AAATGACTAGGTTTTGAAACTGG + Intergenic
1058605486 9:106717816-106717838 ATATGACTATGTTTTAGACACGG - Intergenic
1060452944 9:123760689-123760711 TTAATACTATGTTTTAAAGGGGG + Intronic
1061700724 9:132413349-132413371 AGTTGACTTGGTTTTAAATGAGG - Intronic
1188101531 X:26094035-26094057 ATATAACTATTTTTTAAAGCTGG - Intergenic
1188489021 X:30716849-30716871 ATATGACAAGGCTTTAAAAATGG - Intronic
1188920440 X:35969679-35969701 TTATTTCTAGGTTCTAAAGGTGG + Intronic
1190541857 X:51485231-51485253 ACAGAACTAGGTTGTAAAGGTGG + Intergenic
1190625946 X:52338764-52338786 CTATGACTAGGATATAAAGCAGG - Intergenic
1191961960 X:66713341-66713363 AAATGAGGAGATTTTAAAGGAGG - Intergenic
1194759559 X:97778217-97778239 AGCTGACAAGGTTTCAAAGGTGG + Intergenic
1195450568 X:105007510-105007532 ATATCACTAGGATTTAAATTAGG - Intronic
1196801420 X:119546643-119546665 ATATGACTTGGTGTCTAAGGTGG - Intronic
1197494735 X:127163848-127163870 AGATGAATAGATTTTAAATGTGG + Intergenic
1197816859 X:130506637-130506659 AAATAAATAGGTTTTAAAAGAGG - Intergenic
1198434695 X:136605310-136605332 ATATGACTGGGTTTTGAACTTGG + Intergenic
1198837944 X:140824270-140824292 AAGTGATTAGGTTTTAAATGAGG + Intergenic
1201962650 Y:19699376-19699398 AGATGACCAGGTTATCAAGGTGG + Intergenic