ID: 1135245711

View in Genome Browser
Species Human (GRCh38)
Location 16:20855269-20855291
Sequence AATATGACTAGGTTTTAAAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 227}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135245711_1135245716 15 Left 1135245711 16:20855269-20855291 CCCCTTTAAAACCTAGTCATATT 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1135245716 16:20855307-20855329 TAAGAGCAATTAAGCACAGACGG 0: 1
1: 0
2: 2
3: 12
4: 224
1135245711_1135245715 -8 Left 1135245711 16:20855269-20855291 CCCCTTTAAAACCTAGTCATATT 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1135245715 16:20855284-20855306 GTCATATTCATTAGTGCAACAGG 0: 1
1: 0
2: 0
3: 4
4: 104
1135245711_1135245717 21 Left 1135245711 16:20855269-20855291 CCCCTTTAAAACCTAGTCATATT 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1135245717 16:20855313-20855335 CAATTAAGCACAGACGGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 83
1135245711_1135245719 23 Left 1135245711 16:20855269-20855291 CCCCTTTAAAACCTAGTCATATT 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1135245719 16:20855315-20855337 ATTAAGCACAGACGGAGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1135245711_1135245718 22 Left 1135245711 16:20855269-20855291 CCCCTTTAAAACCTAGTCATATT 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1135245711_1135245721 30 Left 1135245711 16:20855269-20855291 CCCCTTTAAAACCTAGTCATATT 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1135245721 16:20855322-20855344 ACAGACGGAGCTGGGGACCAGGG 0: 1
1: 0
2: 0
3: 25
4: 251
1135245711_1135245720 29 Left 1135245711 16:20855269-20855291 CCCCTTTAAAACCTAGTCATATT 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1135245720 16:20855321-20855343 CACAGACGGAGCTGGGGACCAGG 0: 1
1: 0
2: 1
3: 28
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135245711 Original CRISPR AATATGACTAGGTTTTAAAG GGG (reversed) Exonic
905021720 1:34820237-34820259 AATATGACTAGGGATAAGAGGGG + Intronic
905781629 1:40715588-40715610 AATCTGACCACGTTATAAAGAGG - Intronic
906837903 1:49103722-49103744 AATTTCCCTAGGTTTTGAAGTGG - Intronic
907101135 1:51836777-51836799 AGTATAACTAAATTTTAAAGAGG + Intronic
910473998 1:87587126-87587148 AAAATGAAAATGTTTTAAAGTGG - Intergenic
911688664 1:100806556-100806578 AATAGGACAAGGTGTGAAAGAGG - Intergenic
912480158 1:109977109-109977131 AGGATGACTAGGATTTCAAGAGG - Intergenic
913351602 1:117867263-117867285 AATATCACTTCTTTTTAAAGAGG - Exonic
913553971 1:119945602-119945624 AATATGACAAGAGTTTAAAAAGG + Intronic
914800159 1:150955593-150955615 AAAATGACCTAGTTTTAAAGTGG - Intronic
915332288 1:155120582-155120604 CATTTGACTAGGCTTTAAAAAGG + Intergenic
916304360 1:163312482-163312504 AATTTGGCTAGGTTGAAAAGAGG + Intronic
916623270 1:166525209-166525231 AATATTCCTAAGTTTTAAATGGG + Intergenic
918135112 1:181665412-181665434 AATAAAACTAGATTTTAAAATGG - Intronic
919242988 1:194938830-194938852 TATCTGACCAGGTTTTCAAGGGG + Intergenic
919755483 1:201063588-201063610 AGGATGGCTAGGTCTTAAAGAGG + Intronic
921338101 1:214108100-214108122 AATGAGACTAGTTTTAAAAGAGG - Intergenic
921553423 1:216567744-216567766 AAAATGACTAGGTTAAAAAAAGG + Intronic
924293979 1:242566906-242566928 AATATGAGGAGGGTTAAAAGAGG - Intergenic
1064667068 10:17665067-17665089 AATATTCTTAGGTTTTAAAGGGG + Intronic
1065100605 10:22327303-22327325 AATATGAATAGGGAATAAAGAGG - Intronic
1065540718 10:26764146-26764168 AATATGCCTATGTTTATAAGTGG + Intronic
1065542215 10:26781619-26781641 AATATAACAAGGTTTTCAAGGGG - Intronic
1067063783 10:43092141-43092163 AATATTACTTGGCTTTAAAAAGG + Intronic
1067406081 10:46024713-46024735 AAAATGTTTAGGTTCTAAAGGGG + Intronic
1068337542 10:55655391-55655413 TTTATGATTTGGTTTTAAAGTGG - Intergenic
1068344597 10:55757697-55757719 AATATTAATATTTTTTAAAGTGG - Intergenic
1069195047 10:65541407-65541429 GATATGACATGGTTTTATAGAGG - Intergenic
1070415532 10:76185901-76185923 AATATAACTTTGTATTAAAGTGG + Intronic
1073012517 10:100372561-100372583 AATATGAATAGGTAATAAACAGG - Intergenic
1073388093 10:103144674-103144696 AATGTGACTAGGTTAAAGAGAGG - Intronic
1075774144 10:124968755-124968777 ATTATTACAAGGTTTTAGAGGGG + Intronic
1077150039 11:1068707-1068729 ATTATGACTAGGATTTTATGTGG - Intergenic
1077705457 11:4481066-4481088 AATTTGAATAGGTTTTTAAATGG - Intergenic
1079551429 11:21703788-21703810 GAAATCAGTAGGTTTTAAAGAGG - Intergenic
1079720390 11:23804580-23804602 AATAAGACTAGCTGTTAAACAGG - Intergenic
1079944163 11:26720843-26720865 AATAAGACTAATTTTTAATGAGG - Intronic
1082195126 11:49295005-49295027 AAGAAGACTAGGATTTAAACTGG + Intergenic
1082648949 11:55763034-55763056 AATTTGGCTTGTTTTTAAAGTGG + Intergenic
1085818203 11:79763865-79763887 AATACAAAAAGGTTTTAAAGAGG + Intergenic
1086124054 11:83331693-83331715 AATGTGATTAGTTTTTAATGAGG + Intergenic
1086302587 11:85444439-85444461 AATGTGTCTAGCTTTTAAAAGGG - Intronic
1087799144 11:102484996-102485018 AATCTGACTGGCATTTAAAGTGG - Intronic
1091119222 11:133042802-133042824 AATATGACTTGGTTATACTGAGG - Intronic
1094335651 12:29348413-29348435 AATATGACTATTTTAGAAAGAGG + Intronic
1094360573 12:29626350-29626372 TATATGACTACATTTTAAATAGG + Intronic
1097741428 12:63247150-63247172 AATAAGCCTAGGTTTTAGATTGG - Intergenic
1097900725 12:64871500-64871522 AATTTGACATGTTTTTAAAGTGG + Intronic
1097916234 12:65023023-65023045 AAGGTGCCTATGTTTTAAAGGGG + Intergenic
1097971844 12:65641467-65641489 ATTATGACTCGATTTTACAGAGG + Intergenic
1098320857 12:69241378-69241400 AATATAACTGCGTTTAAAAGAGG + Intronic
1098448526 12:70592712-70592734 AATAAAAAAAGGTTTTAAAGAGG + Intronic
1099024048 12:77443427-77443449 AATATTAATAGGATTTCAAGTGG + Intergenic
1099081107 12:78182493-78182515 AATATGATAAGGTTTGAAGGAGG + Intronic
1099566920 12:84262466-84262488 AATTTGATTATGTTTTGAAGTGG + Intergenic
1100080658 12:90846009-90846031 AATATTACTAGGTAATAAAAAGG + Intergenic
1102852417 12:116261172-116261194 AATAAGAGTAGGTTTTATAAGGG - Intronic
1104327888 12:127817482-127817504 AATGTCATTAGGTTTAAAAGAGG + Intergenic
1104637648 12:130448088-130448110 AATTTGACTTGGTTTGAGAGAGG + Intronic
1108076614 13:46686521-46686543 AATATTTTGAGGTTTTAAAGGGG + Intronic
1109266181 13:60203375-60203397 AATATCGTTTGGTTTTAAAGAGG - Intergenic
1109394181 13:61733365-61733387 ATTATTAATAAGTTTTAAAGTGG - Intergenic
1111460807 13:88539595-88539617 AAAATGCCTAGGTTCTAATGAGG + Intergenic
1112599085 13:100837607-100837629 AATATTACTCAGTTTTAAAAAGG - Intergenic
1113017632 13:105845579-105845601 TAGATGAATAGGTTTTAAAGAGG - Intergenic
1113025389 13:105935554-105935576 AATATGACAAGGTCTTCAAGTGG + Intergenic
1114339653 14:21729912-21729934 AAGAGGACCAGGTTTCAAAGAGG - Intergenic
1115031611 14:28802612-28802634 AATGTGTCTTGGTTTTAAACTGG + Intronic
1118035548 14:61862453-61862475 AATATGTCTACTTTTTAAAAGGG - Intergenic
1118522458 14:66600233-66600255 ATAAGGACTAGGTTTTAAAAAGG - Intronic
1118729597 14:68656995-68657017 ACTATGACTAGGTTGTACTGAGG - Intronic
1119020813 14:71111693-71111715 AAAATAAATAGGTTTTAAAGTGG - Exonic
1119246266 14:73111133-73111155 AATAGGACTAAGTCTTAAACTGG + Exonic
1119345749 14:73922529-73922551 AACATAACCAGGTTTTACAGAGG + Exonic
1120270107 14:82301339-82301361 CATATGACTAGGTTTAAAAAAGG - Intergenic
1121075309 14:91063164-91063186 AAAATGAGTAGGTTTTAACCAGG + Intronic
1122132207 14:99611009-99611031 AATATTTTTAGTTTTTAAAGTGG - Intergenic
1125147304 15:36486817-36486839 AAAATGAGTAAGTTTTAAGGTGG - Intergenic
1125493006 15:40162404-40162426 AATCTGACTTGGGTTTAAATGGG + Intronic
1125610018 15:40963620-40963642 AATATGATTAGGTTTTTATGGGG - Intergenic
1126193022 15:45898788-45898810 AACATGAGTAGGGTTTAGAGAGG + Intergenic
1126246765 15:46515958-46515980 AATATGCCTAGTGTTGAAAGTGG + Intergenic
1126499666 15:49331372-49331394 AATATGATAAGGTTCTAAACAGG - Intronic
1130687957 15:86055695-86055717 TAAATGACTAGGTTGTCAAGTGG + Intergenic
1130741731 15:86607993-86608015 GATAAGACTTGGTTTCAAAGTGG - Intronic
1134611536 16:15613077-15613099 AATATAACTAGTTTCTAAACTGG - Intronic
1135245711 16:20855269-20855291 AATATGACTAGGTTTTAAAGGGG - Exonic
1135709922 16:24707601-24707623 AATATGAATAGTTTTTAAATTGG + Intergenic
1135927408 16:26707731-26707753 AATATTGCTAGATTTTAATGTGG + Intergenic
1136589691 16:31210440-31210462 AATAGGAAGAGGTTTGAAAGAGG - Intergenic
1139083313 16:63552624-63552646 AAAATTACTTTGTTTTAAAGAGG - Intergenic
1140166653 16:72559184-72559206 AATATGACTATTTTTTCATGGGG - Intergenic
1144014442 17:11180623-11180645 AATATGACTAGGATTTTAGAAGG + Intergenic
1145407577 17:22618454-22618476 AATATTAATATTTTTTAAAGTGG - Intergenic
1146429636 17:32779675-32779697 AGTATTACTGGGTTTTAAAGGGG - Intronic
1147801228 17:43090027-43090049 AAAATAACTAGATTTTAAAAGGG + Intronic
1151055874 17:71030984-71031006 AATATTTCTAGGTTTTATGGCGG - Intergenic
1152129874 17:78469725-78469747 AATATGATTTGGTCTTAAAAAGG + Intronic
1153455472 18:5276915-5276937 AAAATGAGTAGCTTTCAAAGAGG + Intergenic
1155922746 18:31619470-31619492 GAAAAGACTAGGTTTTGAAGAGG + Intergenic
1155965927 18:32035402-32035424 AATATAATTAGGAGTTAAAGAGG + Intronic
1156389535 18:36637671-36637693 AATATGAGTAGCTTTAGAAGAGG + Intronic
1162516953 19:11154224-11154246 AATATGACTCAGCTTTAAAATGG + Intronic
925091480 2:1159872-1159894 AATATGATTAGGGATGAAAGGGG + Intronic
927550988 2:23999236-23999258 ATTATGGCTATGTTTTACAGAGG - Intronic
929693402 2:44093323-44093345 GAGATGATTAGGTTGTAAAGAGG + Intergenic
931307889 2:61049803-61049825 AATATGACTAGTTTTCATACTGG + Exonic
935061530 2:99612339-99612361 AATTTGACTAGGTGATAAAATGG - Intronic
937183843 2:120020865-120020887 AACAACACTAGCTTTTAAAGTGG + Intronic
939464516 2:142540265-142540287 CATATGACTATTTTTTAAATTGG + Intergenic
942129390 2:172863554-172863576 AAAATAGCTCGGTTTTAAAGAGG + Intronic
942141432 2:172981065-172981087 AATATGTCCAGATTTTAGAGCGG + Intronic
942191175 2:173472048-173472070 AAAATGGCTAGGTTTTGGAGGGG - Intergenic
942974531 2:181999658-181999680 AAAATGAGTTGGTTTTGAAGTGG + Intronic
942999905 2:182313760-182313782 AACATTAGTAGGTTTTTAAGGGG + Intronic
943018232 2:182540506-182540528 AATTTGGCAAGATTTTAAAGTGG - Intergenic
943388825 2:187235747-187235769 AATATGACCTGTTTTTAAATTGG + Intergenic
944109549 2:196117588-196117610 AACGTGATTAGGTTTTAAATTGG - Intergenic
944816615 2:203383830-203383852 AAAACGACTAGGTCTTAAATAGG - Intronic
945424763 2:209687220-209687242 ATTAAGACTATGTTTTAAACAGG + Intronic
946685747 2:222268177-222268199 AACATGACCAGCCTTTAAAGAGG - Intronic
946736203 2:222756904-222756926 AATATGGCTAGGAAGTAAAGAGG - Intergenic
1170328963 20:15187368-15187390 AATATAAATAAGTTTTAAAATGG + Intronic
1171074641 20:22110212-22110234 AATATGAATAAGCTTAAAAGGGG + Intergenic
1173209608 20:41021958-41021980 ATTATGACAGGGTTTTAAACAGG - Intergenic
1173883227 20:46434877-46434899 AATATGTCTGGGTTTTGCAGGGG + Intergenic
1178943545 21:36927277-36927299 CACATGACTGGGTTTTATAGTGG + Intronic
1184575989 22:45366497-45366519 AATATGACAAGGTTAAAGAGGGG + Intronic
949653409 3:6187963-6187985 AATATTATTCCGTTTTAAAGAGG - Intergenic
950238890 3:11349969-11349991 AAAATGATTAAGTTTTCAAGAGG - Intronic
950249939 3:11456321-11456343 AATATGACTTGGCCTTAAAAAGG - Intronic
950356337 3:12413158-12413180 AATTTGACCAGGGTTTTAAGAGG + Intronic
950410741 3:12834967-12834989 TTTATGACTAGGTTTTGAACAGG + Exonic
952140830 3:30477295-30477317 AATGTAGCTAGATTTTAAAGAGG + Intergenic
954937117 3:54336580-54336602 AATATAACTTCCTTTTAAAGTGG + Intronic
956330682 3:68103449-68103471 AATATGAATAATTATTAAAGGGG + Intronic
956338565 3:68193720-68193742 AAAAAGCCTAGGCTTTAAAGTGG + Intronic
959618615 3:108375889-108375911 AATATATCTATTTTTTAAAGTGG - Intronic
960330431 3:116353218-116353240 AATATGACGAAGTTATAAAAAGG + Intronic
961100753 3:124196684-124196706 AATGTGTTTAGGTTTTAAAAAGG - Intronic
961803803 3:129474156-129474178 AATTTAACTAAGTTTTAAATGGG + Intronic
961957359 3:130817897-130817919 AGTATGGCTTGGATTTAAAGAGG - Intergenic
962686339 3:137851564-137851586 AATAAGACTATGATTTAAAAGGG - Intergenic
963640483 3:147855826-147855848 AATATTACCAGGGATTAAAGAGG + Intergenic
964052762 3:152416974-152416996 CATATGACTAGATTTGAATGTGG + Intronic
964343116 3:155729457-155729479 AGGATGAGTAGGTTTAAAAGAGG + Intronic
964787841 3:160419166-160419188 AATATGGATGGGTTTAAAAGGGG - Intronic
964885304 3:161475251-161475273 AATATTAATTGGTTTTATAGAGG + Intergenic
965532865 3:169792325-169792347 TATCAGACTAGGTTTTAAACTGG - Intergenic
966284833 3:178282833-178282855 AATATTACTAAGCTTTAAAAAGG + Intergenic
967119088 3:186366793-186366815 AATATTACTATATTTTAATGTGG - Intergenic
970891615 4:21051806-21051828 AATATGATGAGGTTTGAAAAAGG + Intronic
971463704 4:26931027-26931049 TATATGAGTAGGTTTTTAAGTGG - Intronic
971659341 4:29391596-29391618 AATATAACTAGGTTAAGAAGTGG - Intergenic
972268536 4:37486169-37486191 AAAATGACAAGGTGCTAAAGTGG - Intronic
972936738 4:44145645-44145667 CATATGACTAGGTTATAATAAGG - Intergenic
973190550 4:47380658-47380680 AATATATCTAGGGTTTTAAGAGG - Intronic
974672520 4:65050760-65050782 AATATGACTTACTTTTTAAGAGG - Intergenic
975701018 4:77066744-77066766 TATCTGATTAGGTTTTTAAGAGG - Intronic
977703872 4:100050686-100050708 AATATCCCTACGGTTTAAAGGGG - Intergenic
977844237 4:101747543-101747565 AAGATGGCTAGGATTTGAAGAGG - Intronic
978122165 4:105092631-105092653 AATGTGACTAAGTTTCAAAGAGG - Intergenic
978732766 4:112049523-112049545 AATATAACTATCTTTTAAAATGG + Intergenic
978885721 4:113764003-113764025 AATCTGACTACTTTTTAAGGAGG - Intergenic
979550425 4:121984929-121984951 AATATGACAATTTTTGAAAGTGG - Intergenic
980210612 4:129782532-129782554 AATAAGACTATATTTTAAAGTGG - Intergenic
980499932 4:133636541-133636563 CATATGACTAGGTTATAAAATGG + Intergenic
982244163 4:153333122-153333144 AATATGACTTGGCATTAAAACGG + Intronic
982553695 4:156834208-156834230 AATCTTGCTAAGTTTTAAAGAGG + Intronic
983615136 4:169695344-169695366 AATGTGAATAGGGTGTAAAGAGG - Intronic
984235924 4:177158854-177158876 AATATCACTAAGCCTTAAAGAGG + Intergenic
984318045 4:178154796-178154818 CATAGGACTAGGATTTTAAGAGG + Intergenic
984457971 4:179995301-179995323 CATATGACAAGTATTTAAAGCGG - Intergenic
984500184 4:180548764-180548786 AATATTACTAAATTTTAAAGTGG - Intergenic
987037562 5:14033282-14033304 AATATGACTAGAATTTAACCAGG - Intergenic
987239129 5:15975332-15975354 AATAACACTAGCTTTTAAACTGG - Intergenic
987396009 5:17424321-17424343 AATATGAGTAGGTTTTGTTGGGG - Intergenic
987420878 5:17718857-17718879 AATATGATTATGTGTAAAAGTGG - Intergenic
987661196 5:20879005-20879027 AAAATCACTAGATTTTAAAAAGG + Intergenic
987812796 5:22859531-22859553 AATATAACTGGGTTTAAAATGGG + Intergenic
989019547 5:36986353-36986375 AAGATTACTAAGTTTTAAAAAGG + Intronic
989740530 5:44766065-44766087 AAAAAGACTAAGTTTTAAACTGG - Intergenic
989993534 5:50798882-50798904 AATATGAAAAGGATTTAAATAGG - Intronic
990672867 5:58152179-58152201 AATATGTCTAGGTTCCATAGAGG - Intergenic
991497433 5:67241027-67241049 AAGATGACTCAGTTCTAAAGAGG - Intergenic
992503043 5:77360202-77360224 AAGACCACTAGGATTTAAAGAGG + Intronic
992751201 5:79864175-79864197 AATATGAAAAGGTTTTTAAATGG - Intergenic
993601304 5:89928328-89928350 AATAACACTAGGATTTAAAGGGG - Intergenic
997111735 5:131082585-131082607 AAAATAACTAGCTTTAAAAGTGG + Intergenic
999455271 5:151710251-151710273 AATATGACTACTTTTAAAAATGG - Intergenic
999641198 5:153674831-153674853 AAAATGACATGGTTTTAAGGAGG + Intronic
999822043 5:155238049-155238071 CAAATGGCTAGGTTTTGAAGGGG + Intergenic
1000967701 5:167679054-167679076 AATGTGATTAGGTTTTCAAGAGG - Intronic
1002904134 6:1435221-1435243 AAAATGACCATGTTGTAAAGAGG + Intergenic
1004050020 6:12067964-12067986 AATATAAGTAGGTCTTAGAGGGG - Intronic
1004149477 6:13101967-13101989 AATACCACTAGGTTTCAAAGAGG + Intronic
1005216189 6:23531380-23531402 AATGTGCCAAGGTTTTGAAGGGG + Intergenic
1005789855 6:29287499-29287521 AAAATGACAAGGTTTAAAAAAGG + Intergenic
1009040575 6:58171345-58171367 AATTTGGCTAGGATTTAAATTGG - Intergenic
1009216431 6:60925875-60925897 AATTTGGCTAGGATTTAAATTGG - Intergenic
1009272803 6:61636410-61636432 AATATGAATAGGTTGAGAAGAGG - Intergenic
1010104572 6:72151467-72151489 AATATGAGTAGGTTATAATGAGG - Intronic
1012422103 6:99077041-99077063 AACATGACTAGGTTGTAATCTGG - Intergenic
1012671356 6:102051856-102051878 AATATGTATATGTTTTCAAGGGG - Intronic
1012977119 6:105792670-105792692 AATATGAGTTTGTTTTAAACTGG + Intergenic
1013423753 6:109991492-109991514 CATATGACTAGGTCTGAGAGTGG - Intergenic
1013505201 6:110793152-110793174 AATATGAGTAGTTTGTTAAGAGG + Intronic
1013826008 6:114212595-114212617 AATATGTCTAAGTTAAAAAGAGG - Intronic
1015031784 6:128603979-128604001 AATATGAATAGGTTTGAGAGGGG + Intergenic
1016444091 6:144115003-144115025 AATATGAATGGGTTGTAAAATGG + Intergenic
1018325978 6:162669373-162669395 AAAACCACTATGTTTTAAAGAGG + Intronic
1018603443 6:165572480-165572502 AATATGACATTGTTATAAAGTGG + Intronic
1020817568 7:12924358-12924380 TATATGAATAGGTTTTAACAGGG + Intergenic
1021539415 7:21740559-21740581 AATATGACTCGGTCTTACATAGG - Intronic
1021936240 7:25634928-25634950 AATATTAATACGTATTAAAGAGG + Intergenic
1023626271 7:42118144-42118166 AAGATGATTAAGCTTTAAAGGGG - Intronic
1026683476 7:72488392-72488414 AATAAGAATAAGTTTTAAAAAGG + Intergenic
1027707030 7:81548417-81548439 AATATAACTAGCCTTTAATGTGG - Intergenic
1030131262 7:106203280-106203302 AATTTGACTTGGATTTGAAGGGG - Intergenic
1031019363 7:116610344-116610366 AAGATGACTCAGTTTTAAATCGG + Intergenic
1032762971 7:134961939-134961961 AATTTCATTAGGTTTTAAAGGGG - Intronic
1033630820 7:143155825-143155847 CCTATGACCAGGTTTTAGAGGGG - Intergenic
1036144006 8:6236098-6236120 ATTATAAATAGGGTTTAAAGTGG + Intergenic
1036790982 8:11719894-11719916 AATATGCTTTAGTTTTAAAGTGG - Intronic
1037575095 8:20195057-20195079 GATCTGATTAGGCTTTAAAGAGG - Intergenic
1038009870 8:23466903-23466925 AATATTATTTGGTCTTAAAGAGG - Intergenic
1039169181 8:34722752-34722774 AATATGTTTTGCTTTTAAAGAGG + Intergenic
1040923198 8:52647676-52647698 AATAAGGCCAGGTTTTAAGGAGG + Intronic
1041940017 8:63376625-63376647 AATATGATAAGATTTTAAATGGG - Intergenic
1042576259 8:70223016-70223038 AGCAAGACTAGGTTTTAATGAGG + Intronic
1043951987 8:86319680-86319702 ATTATTACTGGATTTTAAAGCGG + Intronic
1044066060 8:87701713-87701735 AATATTGCTAATTTTTAAAGAGG + Intergenic
1045023000 8:98060796-98060818 AATGTGACTGGGTTTTTAGGAGG + Intergenic
1045964404 8:108007660-108007682 AAAATGAAGAGTTTTTAAAGAGG - Intronic
1047058451 8:121194173-121194195 AATATTACTCGCTTTTAAAGTGG + Intergenic
1049506137 8:142999931-142999953 AAGTTGGCTAGGATTTAAAGGGG - Intergenic
1050042212 9:1507964-1507986 CATATGACTTGATTTTAAATAGG + Intergenic
1050595050 9:7196677-7196699 ATTATGACAAGTTTTTAAGGTGG - Intergenic
1056419316 9:86408344-86408366 AATATGACTCAGTCTTAAAAAGG - Intergenic
1057609853 9:96531799-96531821 AATAAAACTAGCTTTTATAGTGG + Intronic
1058789238 9:108424601-108424623 AGCAGCACTAGGTTTTAAAGGGG + Intergenic
1059656971 9:116366138-116366160 AATCTGACTAGGCCTGAAAGAGG - Intronic
1060245128 9:121939267-121939289 AATATAACTAGGGTTTATAAAGG + Intronic
1185571641 X:1139192-1139214 AATCTGACCAGGTTTTCATGAGG + Intergenic
1185974832 X:4708812-4708834 AATATAACAACGTTTTAAATGGG + Intergenic
1187939814 X:24370840-24370862 ATTATGACTAGGTTATTAAAAGG - Intergenic
1191586181 X:62829079-62829101 CATATGCCTAGGTGTTGAAGAGG + Intergenic
1195794902 X:108635490-108635512 AGTATGATTAGATTTTAAAAAGG - Intronic
1197797684 X:130315746-130315768 AATATTACTTGGCTTTAAAAAGG - Intergenic
1198089542 X:133313905-133313927 AAAATGGCTAGATTTTAAAGAGG + Intronic
1201746298 Y:17377652-17377674 AATATGATTTGGATTTAAAGTGG + Intergenic