ID: 1135245712

View in Genome Browser
Species Human (GRCh38)
Location 16:20855270-20855292
Sequence GAATATGACTAGGTTTTAAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 259}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135245712_1135245718 21 Left 1135245712 16:20855270-20855292 CCCTTTAAAACCTAGTCATATTC 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1135245712_1135245717 20 Left 1135245712 16:20855270-20855292 CCCTTTAAAACCTAGTCATATTC 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1135245717 16:20855313-20855335 CAATTAAGCACAGACGGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 83
1135245712_1135245715 -9 Left 1135245712 16:20855270-20855292 CCCTTTAAAACCTAGTCATATTC 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1135245715 16:20855284-20855306 GTCATATTCATTAGTGCAACAGG 0: 1
1: 0
2: 0
3: 4
4: 104
1135245712_1135245721 29 Left 1135245712 16:20855270-20855292 CCCTTTAAAACCTAGTCATATTC 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1135245721 16:20855322-20855344 ACAGACGGAGCTGGGGACCAGGG 0: 1
1: 0
2: 0
3: 25
4: 251
1135245712_1135245719 22 Left 1135245712 16:20855270-20855292 CCCTTTAAAACCTAGTCATATTC 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1135245719 16:20855315-20855337 ATTAAGCACAGACGGAGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1135245712_1135245716 14 Left 1135245712 16:20855270-20855292 CCCTTTAAAACCTAGTCATATTC 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1135245716 16:20855307-20855329 TAAGAGCAATTAAGCACAGACGG 0: 1
1: 0
2: 2
3: 12
4: 224
1135245712_1135245720 28 Left 1135245712 16:20855270-20855292 CCCTTTAAAACCTAGTCATATTC 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1135245720 16:20855321-20855343 CACAGACGGAGCTGGGGACCAGG 0: 1
1: 0
2: 1
3: 28
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135245712 Original CRISPR GAATATGACTAGGTTTTAAA GGG (reversed) Exonic
904842532 1:33382415-33382437 GAATAAGAGTAGGAATTAAAAGG - Intronic
905021719 1:34820236-34820258 GAATATGACTAGGGATAAGAGGG + Intronic
908058145 1:60314944-60314966 GAATATTACTAGGCCTTAAAAGG + Intergenic
908202824 1:61815315-61815337 GAGGAAGACTAGGTGTTAAAGGG + Intronic
909401451 1:75236219-75236241 AAATTGGGCTAGGTTTTAAAGGG + Intronic
913400617 1:118428749-118428771 CAATATGAATACGTTTAAAATGG + Intergenic
915042126 1:152977402-152977424 GAAGATGACTAGGGATTATATGG - Intergenic
916623269 1:166525208-166525230 TAATATTCCTAAGTTTTAAATGG + Intergenic
917328089 1:173853807-173853829 CACTATGACTTGGTTTTAAATGG + Exonic
917759383 1:178139953-178139975 GAATAAGACAAACTTTTAAAAGG - Intronic
917867780 1:179213721-179213743 GAATATGACAAGATTTAAAATGG - Intronic
918711693 1:187738280-187738302 CATTATTATTAGGTTTTAAAAGG + Intergenic
919242987 1:194938829-194938851 GTATCTGACCAGGTTTTCAAGGG + Intergenic
920827946 1:209439334-209439356 GAATATAAATATGTTTTTAAAGG + Intergenic
921071061 1:211657872-211657894 AAATAAGACCAAGTTTTAAAGGG - Intergenic
921517826 1:216119340-216119362 GATTTTGACTTAGTTTTAAAAGG - Intronic
921718592 1:218445557-218445579 GAATATAACTCCATTTTAAAGGG + Intergenic
923933902 1:238738253-238738275 GAATATGTCTTGGTCTTCAAAGG + Intergenic
1063983627 10:11477811-11477833 TAATGTGAAAAGGTTTTAAAGGG + Intronic
1064667067 10:17665066-17665088 AAATATTCTTAGGTTTTAAAGGG + Intronic
1064954884 10:20896839-20896861 GAAAGTGACTGTGTTTTAAAAGG + Intronic
1065542216 10:26781620-26781642 AAATATAACAAGGTTTTCAAGGG - Intronic
1066781249 10:38948239-38948261 GAATCTGAATAGTTTTTAAAAGG - Intergenic
1067802599 10:49369404-49369426 GAATATGACTCAGACTTAAAAGG + Intronic
1070907297 10:80084381-80084403 GAACATGAGTAGGTTTAAAAGGG - Intronic
1073174981 10:101549922-101549944 GACTATGACTAGCTTATAATTGG + Intronic
1073901920 10:108232405-108232427 GAATAAACCTAGGTTTTACAGGG + Intergenic
1073919067 10:108438231-108438253 GAATAGGAATAGTTATTAAATGG - Intergenic
1074026233 10:109638212-109638234 GACTTTTACTTGGTTTTAAAAGG + Intergenic
1074843731 10:117378489-117378511 GATTCTGAATAGGTTTTTAAAGG + Intergenic
1074905981 10:117864063-117864085 GATCATGACAAGGCTTTAAAGGG - Intergenic
1074977515 10:118593744-118593766 CAATATGAATGGGATTTAAAAGG - Exonic
1075583303 10:123638712-123638734 GAATATGTGTTGTTTTTAAATGG - Intergenic
1075774143 10:124968754-124968776 GATTATTACAAGGTTTTAGAGGG + Intronic
1075808580 10:125208063-125208085 GAATATGATGAAGTTTGAAATGG + Intergenic
1076495396 10:130893879-130893901 AAATATGACTGCGTTTTAGAGGG + Intergenic
1078813058 11:14790432-14790454 GAATATAGTTGGGTTTTAAAAGG + Intronic
1080239638 11:30111900-30111922 GTATTTTAGTAGGTTTTAAATGG - Intergenic
1085160878 11:74343393-74343415 AAACATTACCAGGTTTTAAATGG - Exonic
1086302588 11:85444440-85444462 AAATGTGTCTAGCTTTTAAAAGG - Intronic
1092786121 12:12028632-12028654 GAATCTGACAAGGTTTTAATAGG + Intergenic
1093006474 12:14057117-14057139 GAATATTAATAGGATTTAGAAGG - Intergenic
1093316795 12:17662331-17662353 GAATATTACTTGTTCTTAAATGG - Intergenic
1093349697 12:18082941-18082963 TAAAATCACTAGGCTTTAAATGG + Intronic
1094175039 12:27532649-27532671 GGATTTGACTGGGTCTTAAAGGG + Intronic
1095918904 12:47509104-47509126 GATTATGACTGGGTTATATAAGG - Intergenic
1096705141 12:53416114-53416136 GATTATTAAGAGGTTTTAAAAGG - Intronic
1097947476 12:65387984-65388006 GAATGTGACTGAGTTCTAAATGG + Intronic
1101261052 12:103030473-103030495 GAAATTGACCAGGTTTTATATGG + Intergenic
1102852418 12:116261173-116261195 CAATAAGAGTAGGTTTTATAAGG - Intronic
1106322445 13:28654786-28654808 GAAAATTACTAGGTTTTCGAGGG - Intergenic
1108026275 13:46181819-46181841 GAACATGGTTTGGTTTTAAAAGG + Intronic
1108929843 13:55805347-55805369 GAATAGAACTAGGTGTTAATCGG - Intergenic
1109490908 13:63099190-63099212 GAATATTACTACGTCTTAAAAGG + Intergenic
1109538807 13:63746065-63746087 GAAGCTGGTTAGGTTTTAAAAGG + Intergenic
1109545028 13:63833699-63833721 GAAGCTGGTTAGGTTTTAAAAGG - Intergenic
1109776245 13:67044572-67044594 GAATTAGACTTGTTTTTAAAGGG - Intronic
1111966110 13:94863690-94863712 GAATATGTATGGTTTTTAAAGGG + Intergenic
1112241978 13:97691209-97691231 GAAAATGACTGGGTTTTATATGG - Intergenic
1112822046 13:103349031-103349053 GAATATGGCTAGGATTGTAATGG - Intergenic
1113581344 13:111431964-111431986 GAATATGAAAAGATCTTAAAAGG + Intergenic
1114039198 14:18660622-18660644 GGACATGAGTAGGTTTAAAAGGG - Intergenic
1115893592 14:38059759-38059781 GAATATTAATATATTTTAAATGG + Intergenic
1115981114 14:39052494-39052516 GAAAATCAGTAGGTTTTACATGG + Intronic
1116136523 14:40930999-40931021 AAATATTACTACGTTTTTAAAGG - Intergenic
1116676405 14:47911546-47911568 CAATATGACATGTTTTTAAAAGG - Intergenic
1116773619 14:49154922-49154944 GAATAGGATTAGCTTTAAAAAGG - Intergenic
1116845092 14:49857922-49857944 GAATACAACTAGGTTTTATTAGG - Intergenic
1117565411 14:56989658-56989680 GAATTTGAGTGGATTTTAAATGG + Intergenic
1117660983 14:58004715-58004737 GAATTGGACTGGGTTTTAATTGG - Exonic
1118035549 14:61862454-61862476 AAATATGTCTACTTTTTAAAAGG - Intergenic
1118514800 14:66515384-66515406 GAAGTTGATTAGTTTTTAAAAGG + Intronic
1120456864 14:84741834-84741856 GAATTTGATTAAGTTTCAAAAGG - Intergenic
1122169875 14:99863671-99863693 GAATATGAGTTGGTGATAAAAGG - Intronic
1122590713 14:102848425-102848447 GATTATTATTATGTTTTAAAGGG - Intronic
1124046941 15:26159326-26159348 GAATCAGACTAGTTTTTCAAAGG + Intergenic
1124509387 15:30310134-30310156 GCATATAAGTAGGTCTTAAATGG - Intergenic
1124734173 15:32228528-32228550 GCATATAAGTAGGTCTTAAATGG + Intergenic
1125075916 15:35618131-35618153 GAATATAAATAAATTTTAAAGGG - Intergenic
1125493005 15:40162403-40162425 TAATCTGACTTGGGTTTAAATGG + Intronic
1125610019 15:40963621-40963643 GAATATGATTAGGTTTTTATGGG - Intergenic
1128933930 15:71729652-71729674 GAATCTGAATATATTTTAAATGG + Intronic
1129437898 15:75557032-75557054 GAATATTACTCGGCCTTAAAAGG - Intronic
1133639233 16:7700832-7700854 GAATAGGAAGAGGTTTTGAATGG + Intronic
1135245712 16:20855270-20855292 GAATATGACTAGGTTTTAAAGGG - Exonic
1135379676 16:21984924-21984946 GAATATTAGGAGGTGTTAAAGGG + Intronic
1135486237 16:22867992-22868014 GTATATGATCAAGTTTTAAAAGG + Intronic
1137016936 16:35386429-35386451 GAATTTAAATAGGATTTAAATGG + Intergenic
1138723881 16:59114679-59114701 GAAAATGACTAACTTTTTAAAGG - Intergenic
1140074172 16:71681700-71681722 GATTATGAGTTGGTTTTAACAGG + Intronic
1140575213 16:76159771-76159793 CTATATTACCAGGTTTTAAAAGG - Intergenic
1140888429 16:79264642-79264664 AAAGATGACTAGGTCTTAAGAGG - Intergenic
1143577107 17:7800490-7800512 TGATATGACTAGATTTTTAAGGG + Intronic
1145710492 17:26968675-26968697 GAATCTGAATAGTTTTTAAAAGG - Intergenic
1146247245 17:31298373-31298395 AAATATTACTCGTTTTTAAATGG - Intronic
1146429637 17:32779676-32779698 CAGTATTACTGGGTTTTAAAGGG - Intronic
1147801227 17:43090026-43090048 AAAAATAACTAGATTTTAAAAGG + Intronic
1147958521 17:44151655-44151677 GAATATGACTGGTTTCAAAATGG + Intronic
1153508166 18:5824629-5824651 GAATTTAAATATGTTTTAAATGG - Intergenic
1153567475 18:6433079-6433101 GAATCAGACTTTGTTTTAAAAGG - Intergenic
1154144795 18:11858461-11858483 GCATATGATTACATTTTAAAGGG - Intronic
1154998118 18:21660699-21660721 GAATATGATGAAGTTTTAGATGG + Intronic
1155269692 18:24127861-24127883 CAACATGATTAGGTTTTAATAGG - Intronic
1155703893 18:28783654-28783676 CAATATGCCTAAATTTTAAAAGG - Intergenic
1156852121 18:41740909-41740931 GAATATGACTTGAATTTAATTGG + Intergenic
1157076117 18:44469658-44469680 GAATGTGACTAGACTTTAAGAGG - Intergenic
1157092169 18:44649487-44649509 AAATAAAACTATGTTTTAAAAGG + Intergenic
1157142367 18:45122472-45122494 CGATCTGACTAGGTTTTACAAGG + Intergenic
1157272713 18:46288886-46288908 TAATATGTGTAGGTGTTAAAAGG + Intergenic
1157509264 18:48257672-48257694 GAATTTGACAATATTTTAAAAGG + Intronic
1157731201 18:50005964-50005986 AAATATGACAAGGTCTTAAAAGG - Intronic
1157876045 18:51274748-51274770 GGCTGTGACTATGTTTTAAAAGG - Intergenic
1158250102 18:55478387-55478409 GAATTTGATTTGGTTTTACATGG - Intronic
1159904893 18:74080878-74080900 GAATGTGACTGTCTTTTAAAGGG - Intronic
1162579665 19:11521117-11521139 GAATATAACCAGGTTTTGTATGG + Intronic
1164067152 19:21726413-21726435 GAATGTGATAAAGTTTTAAATGG - Exonic
1166628389 19:44382568-44382590 GATTAGGACTAAGTTTTATAGGG + Exonic
1168488522 19:56786685-56786707 GAATTTCACTAAGTTTTAAGGGG + Intronic
925196461 2:1929902-1929924 GAATATGTCCCGGTTTTGAAAGG - Intronic
926021649 2:9501751-9501773 TAATATAACAAGGTTTTTAATGG - Intronic
927567018 2:24122577-24122599 GACTCTGGCTAGCTTTTAAAAGG + Intronic
928047151 2:27947111-27947133 GAAAATGTCTACCTTTTAAATGG + Intronic
928558690 2:32454747-32454769 GAATAGCAGGAGGTTTTAAAAGG + Intronic
928884341 2:36130897-36130919 GAAAATTAATAGGTTTAAAATGG + Intergenic
929014034 2:37476219-37476241 GAATTTGACTAAGTTTTGTAAGG + Intergenic
930963871 2:57295603-57295625 GAATATAAATATGTTATAAAAGG + Intergenic
931556814 2:63515032-63515054 GAAGATGTCTAGGTATTCAAAGG + Intronic
933339679 2:81006366-81006388 GAATATTACTAGGGATGAAAGGG + Intergenic
934225996 2:90131678-90131700 AAATATGACCAGTTTTTATAGGG + Intergenic
934456317 2:94167337-94167359 GATTCTGTCTAGGTTTTATATGG - Intergenic
934611191 2:95737960-95737982 GAATATTACTTGTTTTTAAAGGG + Intergenic
935629656 2:105202808-105202830 GAATTTGAATAGCTTTGAAATGG + Intergenic
935706121 2:105859317-105859339 GGATATGATCAGGTTGTAAATGG - Intronic
936544521 2:113379547-113379569 GAATATTACTTGTTTTTAAAGGG + Intergenic
937775145 2:125767313-125767335 GAATATGGAAAGGTTTCAAAAGG + Intergenic
938271404 2:129975338-129975360 GGACATGAGTAGGTTTAAAAGGG + Intergenic
938545206 2:132322629-132322651 GATTAGGACTAAGTTTTATAGGG - Intergenic
940552576 2:155179801-155179823 AAAAATGATTAGGTTCTAAAAGG + Intergenic
940735660 2:157448926-157448948 GGATGTGCATAGGTTTTAAAAGG + Intronic
941426844 2:165357564-165357586 GATTATGACATGATTTTAAATGG - Intronic
941909609 2:170751159-170751181 GAATATTACTAGGGATAAAAAGG + Intergenic
943331923 2:186570138-186570160 GAATAGAACCAGGTTTTAATAGG + Intergenic
944279456 2:197878509-197878531 GAATATGAATGCATTTTAAATGG + Intronic
944519535 2:200550542-200550564 GAAGATGAGTTGGTTGTAAATGG - Intronic
944769168 2:202896341-202896363 TCATATGGCCAGGTTTTAAAAGG + Intronic
944942528 2:204644163-204644185 TAACATGGCTGGGTTTTAAAGGG - Intronic
1170452965 20:16504940-16504962 GAATATGATAAGTTTTGAAAAGG + Intronic
1171074640 20:22110211-22110233 GAATATGAATAAGCTTAAAAGGG + Intergenic
1171874059 20:30555412-30555434 GATTAGGACTAAGTTTTATAGGG - Intergenic
1173453224 20:43183869-43183891 GAATATGACTAGGAATAAAAAGG - Intronic
1173883226 20:46434876-46434898 GAATATGTCTGGGTTTTGCAGGG + Intergenic
1176977706 21:15341465-15341487 GAATATGACTTAGATTTAGAGGG + Intergenic
1177323348 21:19551218-19551240 AAATATAACGATGTTTTAAAAGG - Intergenic
1177621657 21:23602702-23602724 AAATGTGACTCAGTTTTAAATGG + Intergenic
1184368369 22:44067366-44067388 AAATGTGATTAGCTTTTAAAAGG - Intronic
1203288707 22_KI270735v1_random:11985-12007 GAATCTGAATAGTTTTTAAAAGG + Intergenic
949219822 3:1618427-1618449 CAATATGATTATTTTTTAAAGGG - Intergenic
950812317 3:15660616-15660638 GAATATGAGTCATTTTTAAATGG - Intergenic
951693612 3:25422817-25422839 GTATATAGCTAGGTTTTATAAGG + Intronic
952647568 3:35680127-35680149 GAACATGACCAGATTTAAAATGG - Intronic
953506453 3:43490445-43490467 AAATATGACCTTGTTTTAAAAGG - Intronic
953634139 3:44648171-44648193 GAATATGACTGGTTATTAGATGG + Intronic
955317588 3:57951736-57951758 GAATGTGGCTAGGTTTGAAAAGG + Intergenic
955667038 3:61360842-61360864 TTATATGACTAGGTTTTAATGGG + Intergenic
955684484 3:61536363-61536385 GAATATGGTTACTTTTTAAAGGG + Intergenic
957379574 3:79408727-79408749 GAAAATAATTAAGTTTTAAAGGG + Intronic
957452520 3:80397938-80397960 GTATATCATTAGGTTTCAAAAGG - Intergenic
958126832 3:89367233-89367255 GTATATAAATAGATTTTAAAAGG - Intronic
959122373 3:102247835-102247857 GAATATGAATAGAATTTCAAAGG + Intronic
959761643 3:109972995-109973017 GAATATTATTAGCTTTAAAAAGG + Intergenic
960450711 3:117804028-117804050 GAAGATGACTGGGATTTAGATGG - Intergenic
961380805 3:126495486-126495508 GAATATGACTCGGCCTCAAACGG - Intronic
961803802 3:129474155-129474177 TAATTTAACTAAGTTTTAAATGG + Intronic
962686340 3:137851565-137851587 AAATAAGACTATGATTTAAAAGG - Intergenic
962840052 3:139225174-139225196 GAATATGACTAATTTTGAACAGG - Intronic
963044216 3:141090752-141090774 TGATTTGCCTAGGTTTTAAAAGG + Intronic
965616226 3:170595477-170595499 GAATATTATTTAGTTTTAAAAGG - Intronic
967630289 3:191737478-191737500 GAGTAGGACTAGGTTTTATTGGG + Intergenic
967856569 3:194122327-194122349 GAATTTAACTAAGTTTTTAATGG - Intergenic
968035831 3:195546808-195546830 GAATTTAACCAGTTTTTAAAAGG - Intergenic
969263897 4:6051726-6051748 ATAAATGACAAGGTTTTAAAAGG + Intronic
970130864 4:12869204-12869226 CAACATGAATAGGTTTTAACTGG - Intergenic
971007068 4:22387165-22387187 AAATATTACCAGGTTTTAAAAGG - Intronic
971081319 4:23215178-23215200 GAATATTTGTAAGTTTTAAATGG - Intergenic
971763185 4:30796090-30796112 GAGAATGTCAAGGTTTTAAAGGG - Intronic
975070341 4:70128863-70128885 GAATATAATTATATTTTAAATGG + Intergenic
975136285 4:70877622-70877644 CCATATGACAAAGTTTTAAATGG - Intergenic
975839558 4:78459145-78459167 GAATATGAGTGTCTTTTAAAAGG + Intronic
977835755 4:101644639-101644661 AACTATGACTAGGCTTAAAATGG - Intronic
978298827 4:107242043-107242065 GGATATGACTATGTTATCAAAGG - Intronic
982721869 4:158868263-158868285 GAAGGTGACCAAGTTTTAAATGG + Exonic
982850421 4:160308306-160308328 AAATCTGGCTTGGTTTTAAACGG - Intergenic
983705603 4:170654829-170654851 GATTATGAATGGGTTTTTAAAGG - Intergenic
984305984 4:177991199-177991221 TTATATTACTAGGTTTCAAATGG - Intergenic
985679984 5:1250835-1250857 GAAAATAACAAAGTTTTAAAGGG - Intergenic
986458537 5:7944822-7944844 GAATATGTCTAACTTTCAAATGG + Intergenic
986972086 5:13348781-13348803 GAATATGAGTAAGTCTTACACGG - Intergenic
987396010 5:17424322-17424344 GAATATGAGTAGGTTTTGTTGGG - Intergenic
987812795 5:22859530-22859552 AAATATAACTGGGTTTAAAATGG + Intergenic
989060329 5:37404619-37404641 GAATATGATTATGATTTAATAGG - Intronic
990861724 5:60334920-60334942 GACTATCATTAGGTTGTAAATGG - Intronic
991735090 5:69624497-69624519 GAATATTACTTGGTCTCAAAAGG - Intergenic
991779888 5:70122222-70122244 GAATATTACTTGGTCTCAAAAGG + Intergenic
991811524 5:70479633-70479655 GAATATTACTTGGTCTCAAAAGG - Intergenic
991859175 5:70997650-70997672 GAATATTACTTGGTCTCAAAAGG + Intronic
991872335 5:71122543-71122565 GAATATTACTTGGTCTCAAAAGG + Intergenic
993601305 5:89928329-89928351 AAATAACACTAGGATTTAAAGGG - Intergenic
994201051 5:96976468-96976490 GAATATCTCTTGGCTTTAAATGG + Intronic
995911348 5:117191281-117191303 GAATAAGACTTGGATTTATAAGG + Intergenic
996330010 5:122318031-122318053 GACTATGACAAGGTTTGGAATGG - Intronic
1001678954 5:173542208-173542230 GTATAAGCCTAGGTTTTGAATGG + Intergenic
1005174253 6:23025943-23025965 GAATATTACTAGACTTTCAATGG + Intergenic
1005713668 6:28526281-28526303 GAATATGACTAGGGAAGAAAGGG + Intronic
1007023842 6:38549771-38549793 GAATAGGAGTAGGTTCAAAATGG - Intronic
1007953569 6:45895829-45895851 GAATAGTACTGGGTTTTAACTGG + Intergenic
1008201345 6:48594299-48594321 AAATATGTCTATCTTTTAAAAGG - Intergenic
1008726619 6:54429406-54429428 GAATCTGACTTTCTTTTAAAAGG - Intergenic
1009324580 6:62334776-62334798 GAATATTATCAGTTTTTAAATGG + Intergenic
1009370279 6:62891950-62891972 GATTTTGACAAGGTCTTAAAAGG - Intergenic
1010083896 6:71893243-71893265 GAATTTGACAAGGAGTTAAAAGG + Intronic
1011855601 6:91686056-91686078 GAATATGGCTATTTTTAAAATGG + Intergenic
1012163673 6:95921622-95921644 AAATATGACTAGAAATTAAATGG - Intergenic
1012351209 6:98252868-98252890 GAGAATCAGTAGGTTTTAAATGG + Intergenic
1012403132 6:98861326-98861348 TAATCTGACTATGTTTTAAAAGG + Intergenic
1012513927 6:100036776-100036798 GAATATGACAAGGGTTTAACAGG - Intergenic
1013146055 6:107393833-107393855 GAATATTACAAGGGTTAAAAAGG - Intronic
1013990083 6:116243574-116243596 GAATATAAAAAGGTTTTAAGAGG - Intronic
1015031783 6:128603978-128604000 AAATATGAATAGGTTTGAGAGGG + Intergenic
1015150134 6:130028319-130028341 AAATATGACTAGCTGATAAAGGG + Intronic
1015599762 6:134900916-134900938 GAATCTAAATAGGTTTTTAAAGG - Intergenic
1017009865 6:150056049-150056071 AAATATTACTAAGTTTTTAAAGG - Intergenic
1018563939 6:165131664-165131686 GAATGTGATTGGGTTTTAGATGG - Intergenic
1018717536 6:166545159-166545181 GAAAATGACCAGGGTTGAAATGG - Intronic
1018793073 6:167164539-167164561 AAATAAGACTAGGTTTAAAAAGG + Intronic
1020384776 7:7588253-7588275 GAATTTGGCTAGTGTTTAAAAGG + Intronic
1020817567 7:12924357-12924379 ATATATGAATAGGTTTTAACAGG + Intergenic
1021007662 7:15419860-15419882 AAGGATGACTATGTTTTAAATGG - Intronic
1021439649 7:20663397-20663419 GAATACTACCAGTTTTTAAAAGG + Intronic
1023272123 7:38475132-38475154 GAATATGGCTAGGATTAAAAAGG - Intronic
1023670285 7:42569347-42569369 TAAAATGACTATATTTTAAAAGG - Intergenic
1026364756 7:69636577-69636599 GAAAAATACTAGGTTGTAAATGG - Intronic
1027719744 7:81725125-81725147 CAATCTGACTAAGTTTTAACTGG - Intronic
1030184238 7:106745124-106745146 GATTATGACAAGGAATTAAATGG - Intergenic
1030625024 7:111835326-111835348 GAATAAAACTATTTTTTAAAAGG - Intronic
1030963457 7:115957095-115957117 GCATATGACCTGGTTATAAATGG + Intronic
1031002873 7:116437871-116437893 CAATAAGACATGGTTTTAAAAGG + Intronic
1032563012 7:132912139-132912161 GAATAGCAGTAGGTATTAAATGG - Intronic
1032598086 7:133262586-133262608 CACAATGAATAGGTTTTAAATGG - Intronic
1032710188 7:134454439-134454461 GAAGAAGACTAGGTTTTAAAAGG - Intronic
1032762972 7:134961940-134961962 AAATTTCATTAGGTTTTAAAGGG - Intronic
1040113783 8:43590835-43590857 GATTCTGTCTAGGTTTTAATTGG - Intergenic
1040992291 8:53365562-53365584 CGAAATGTCTAGGTTTTAAAAGG + Intergenic
1041168741 8:55118694-55118716 GAATATGACTTGCGTTGAAAGGG + Intronic
1041940018 8:63376626-63376648 TAATATGATAAGATTTTAAATGG - Intergenic
1042797285 8:72678301-72678323 TAATGTGACTATGTTTTAAAAGG - Intronic
1042896177 8:73670643-73670665 GAATAGAACTAAGTTTTAAATGG + Intronic
1043781170 8:84336921-84336943 GAACATTGCTAGGTTTAAAATGG + Intronic
1044405992 8:91826913-91826935 AAATATGATGTGGTTTTAAAAGG + Intergenic
1046346854 8:112940586-112940608 GAATATAACAAGTTTTTAAAGGG - Intronic
1047622109 8:126618490-126618512 TAATATGACAAGTTTTGAAAAGG - Intergenic
1050296815 9:4213340-4213362 GAATATGTACAGGTTTTAAAGGG - Intronic
1051172351 9:14331427-14331449 GAATGTGCCTGGGGTTTAAAAGG - Intronic
1051466866 9:17388780-17388802 TAATATGACTAAGGTTTACATGG - Intronic
1052022762 9:23543707-23543729 GTTTCTGACTAGTTTTTAAAAGG - Intergenic
1052265561 9:26567956-26567978 GAATATGACTCAGTCATAAAAGG - Intergenic
1052493580 9:29197288-29197310 GATTTTGAATAGGTTTTTAATGG - Intergenic
1054708477 9:68486617-68486639 GAATATTACTTGGTAATAAAAGG - Intronic
1054986246 9:71264825-71264847 GAAGATGAAGTGGTTTTAAAAGG - Intronic
1058291956 9:103253614-103253636 GTATCTGACTTTGTTTTAAAGGG + Intergenic
1059387284 9:113974465-113974487 TAATATGATTTGGTTTTAAAAGG + Intronic
1185733873 X:2482650-2482672 AATTATGTTTAGGTTTTAAAAGG - Intronic
1185974831 X:4708811-4708833 TAATATAACAACGTTTTAAATGG + Intergenic
1187290303 X:17946845-17946867 GAATATGGCTATGATTTAGAAGG + Intergenic
1187956282 X:24522336-24522358 GCATTTGACATGGTTTTAAAAGG + Intronic
1188438329 X:30188589-30188611 CATCATGAGTAGGTTTTAAAAGG + Intergenic
1189140595 X:38601442-38601464 AAATTTTACAAGGTTTTAAATGG - Intronic
1189687858 X:43584662-43584684 GAATATTACTTGGTGATAAAAGG - Intergenic
1189741576 X:44122612-44122634 GGATATGTTAAGGTTTTAAATGG + Intergenic
1189783377 X:44537391-44537413 GATTTTGACTTGGTTTTATATGG - Intronic
1192356621 X:70410070-70410092 GAATATAACTGGGCTTTAAAGGG + Intronic
1194110900 X:89833463-89833485 GAATATGACATAGTTATAAATGG - Intergenic
1194143836 X:90239726-90239748 GAAAAATACTAGGTTTTCAAAGG + Intergenic
1198776917 X:140189579-140189601 GAAAATGACTAGATTTTAATGGG + Intergenic
1198832757 X:140768227-140768249 AAATATGATCAGGTTGTAAAGGG + Intergenic
1199201524 X:145095342-145095364 GATTATTAAGAGGTTTTAAAAGG - Intergenic
1200463558 Y:3488209-3488231 GAATATGACATAGTTATAAATGG - Intergenic
1200489598 Y:3809027-3809049 GAAAAACACTAGGTTTTCAAAGG + Intergenic
1200545017 Y:4509045-4509067 GAATATAACTTTTTTTTAAACGG - Intergenic
1202197711 Y:22311717-22311739 GAATGTAAATAGATTTTAAAAGG + Intronic
1202594634 Y:26523767-26523789 GAATATTACTAGATTTAAAGAGG + Intergenic