ID: 1135245713

View in Genome Browser
Species Human (GRCh38)
Location 16:20855271-20855293
Sequence TGAATATGACTAGGTTTTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 238}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135245713_1135245718 20 Left 1135245713 16:20855271-20855293 CCTTTAAAACCTAGTCATATTCA 0: 1
1: 0
2: 4
3: 17
4: 238
Right 1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1135245713_1135245717 19 Left 1135245713 16:20855271-20855293 CCTTTAAAACCTAGTCATATTCA 0: 1
1: 0
2: 4
3: 17
4: 238
Right 1135245717 16:20855313-20855335 CAATTAAGCACAGACGGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 83
1135245713_1135245715 -10 Left 1135245713 16:20855271-20855293 CCTTTAAAACCTAGTCATATTCA 0: 1
1: 0
2: 4
3: 17
4: 238
Right 1135245715 16:20855284-20855306 GTCATATTCATTAGTGCAACAGG 0: 1
1: 0
2: 0
3: 4
4: 104
1135245713_1135245719 21 Left 1135245713 16:20855271-20855293 CCTTTAAAACCTAGTCATATTCA 0: 1
1: 0
2: 4
3: 17
4: 238
Right 1135245719 16:20855315-20855337 ATTAAGCACAGACGGAGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1135245713_1135245716 13 Left 1135245713 16:20855271-20855293 CCTTTAAAACCTAGTCATATTCA 0: 1
1: 0
2: 4
3: 17
4: 238
Right 1135245716 16:20855307-20855329 TAAGAGCAATTAAGCACAGACGG 0: 1
1: 0
2: 2
3: 12
4: 224
1135245713_1135245721 28 Left 1135245713 16:20855271-20855293 CCTTTAAAACCTAGTCATATTCA 0: 1
1: 0
2: 4
3: 17
4: 238
Right 1135245721 16:20855322-20855344 ACAGACGGAGCTGGGGACCAGGG 0: 1
1: 0
2: 0
3: 25
4: 251
1135245713_1135245720 27 Left 1135245713 16:20855271-20855293 CCTTTAAAACCTAGTCATATTCA 0: 1
1: 0
2: 4
3: 17
4: 238
Right 1135245720 16:20855321-20855343 CACAGACGGAGCTGGGGACCAGG 0: 1
1: 0
2: 1
3: 28
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135245713 Original CRISPR TGAATATGACTAGGTTTTAA AGG (reversed) Exonic
903004109 1:20287113-20287135 TGAATATTACTATGTTATAGGGG - Intergenic
903404145 1:23082300-23082322 TGGAAATGACTATGATTTAATGG + Exonic
904625735 1:31800885-31800907 TGAATGTGACTGGGGGTTAAGGG - Intronic
905060394 1:35135090-35135112 TAAGCATGATTAGGTTTTAATGG + Intergenic
908703679 1:66928178-66928200 TCAATATTACTAGTTTTAAATGG - Intronic
908890936 1:68847175-68847197 GGAATAAGATGAGGTTTTAAAGG + Intergenic
909401450 1:75236218-75236240 TAAATTGGGCTAGGTTTTAAAGG + Intronic
913369314 1:118080287-118080309 TGACTATGACTAGGATTCAGTGG - Intronic
913821577 1:123075051-123075073 TGATTCTGTCTAGTTTTTAAAGG - Intergenic
913847860 1:123546439-123546461 TGAATCTGTCTAGTTTTTATAGG - Intergenic
913862737 1:123813264-123813286 TGATTCTGTCTAGTTTTTAAAGG - Intergenic
915304074 1:154968078-154968100 TGAAAAGGACTGGGTTTTAGGGG - Intronic
916270005 1:162930483-162930505 TGAATATGAATATGTTCTTATGG - Intergenic
918743629 1:188169685-188169707 TGAAGATGACTTGGATTTGATGG + Intergenic
919040564 1:192382636-192382658 TGGATATTACGAGGTCTTAATGG - Intergenic
919242986 1:194938828-194938850 TGTATCTGACCAGGTTTTCAAGG + Intergenic
919422568 1:197388958-197388980 TGAACATGACTAGTTATTAGAGG + Intronic
921467567 1:215507908-215507930 TGAATATGATTAAATTTAAAAGG + Intergenic
922046537 1:221950877-221950899 TAAAGGTGATTAGGTTTTAATGG - Intergenic
923275833 1:232395447-232395469 TCAATATGTTTAGTTTTTAAGGG + Intergenic
923895583 1:238266621-238266643 TAAATATGTGTAGGTTTTCATGG - Intergenic
1063899120 10:10713662-10713684 TGCATATGAATAGGTCTTAGAGG - Intergenic
1063983626 10:11477810-11477832 TTAATGTGAAAAGGTTTTAAAGG + Intronic
1067358940 10:45558972-45558994 GGAATATTACTTGGTTTAAAAGG - Intronic
1067360531 10:45574153-45574175 TAAGGGTGACTAGGTTTTAATGG - Intronic
1067745194 10:48930274-48930296 AGAATATGAATATGTTTTAAGGG + Intronic
1068382121 10:56269271-56269293 TGAAAATGATTAAGTTTTATTGG - Intergenic
1068564389 10:58556185-58556207 TGAATATGTCTAATTTTTATTGG + Intronic
1069361592 10:67649249-67649271 TGAAAATGACATGTTTTTAAAGG - Intronic
1070363257 10:75711494-75711516 TTAAAATGACTATGCTTTAAAGG - Intronic
1070907298 10:80084382-80084404 TGAACATGAGTAGGTTTAAAAGG - Intronic
1071279240 10:84084888-84084910 TCAATTTGACTAGGTTTTTATGG + Intergenic
1071550661 10:86564001-86564023 TGAGGGTGATTAGGTTTTAATGG + Intergenic
1072607142 10:96994237-96994259 TGAAATGGGCTAGGTTTTAAAGG - Intergenic
1074149235 10:110743453-110743475 TGTTAATTACTAGGTTTTAATGG + Intronic
1074342734 10:112649903-112649925 TGAATATGAATAGAGGTTAAAGG + Intronic
1077754269 11:5008802-5008824 TGAATAAGACTTAGTTTAAATGG - Intergenic
1080071131 11:28088437-28088459 TTAATATGATTTTGTTTTAAAGG - Intronic
1080286327 11:30618069-30618091 TGGATATGACTAGAATTTATTGG + Intergenic
1080352099 11:31397013-31397035 GATATATGACTAGGTTTTGAAGG - Intronic
1082054625 11:47803353-47803375 TCCATTTGACTAGGTTTTAGGGG - Intronic
1082197641 11:49324197-49324219 TAAAGGTGATTAGGTTTTAATGG + Intergenic
1082624808 11:55470793-55470815 TGAAAATGACCAACTTTTAATGG + Intergenic
1082764387 11:57155752-57155774 TGAATTTGAATTGGGTTTAATGG + Intergenic
1082907366 11:58324172-58324194 TGAATTTAACTAAGTTTTCAAGG - Intergenic
1083529605 11:63407695-63407717 TGTATGTACCTAGGTTTTAACGG + Intronic
1086658184 11:89383930-89383952 TAAAGGTGATTAGGTTTTAATGG - Intronic
1086845986 11:91750253-91750275 TTAATATGACTCACTTTTAAAGG - Intergenic
1087624060 11:100575698-100575720 TGTATAAGACTATATTTTAATGG - Intergenic
1087874012 11:103333655-103333677 TGCACATGACTATTTTTTAATGG + Intronic
1089819825 11:121214345-121214367 TAAATTTGAGTAGGTTTTTAAGG + Intergenic
1093321858 12:17723035-17723057 TGAGGGTGATTAGGTTTTAATGG + Intergenic
1093578945 12:20766318-20766340 TGAGGGTGATTAGGTTTTAATGG - Intergenic
1094267244 12:28573051-28573073 TCAATATTACTAGTATTTAAGGG + Intronic
1095030111 12:37262434-37262456 TGAATCTGTCTAGGTTTCATTGG + Intergenic
1095602267 12:44027481-44027503 TTAAAATGTCTAGGTTATAAAGG - Intronic
1095998898 12:48112895-48112917 TAAAGGTGATTAGGTTTTAATGG + Intronic
1099928132 12:89042599-89042621 TGAATATGACTAAGTCTTGGTGG + Intergenic
1100853995 12:98741976-98741998 TGAATATGAATTGCTTTGAATGG + Intronic
1102316536 12:111892534-111892556 TGTATATCAGTACGTTTTAAGGG - Intronic
1106238984 13:27893320-27893342 TGAATCTCAATAGATTTTAAAGG - Intergenic
1106529069 13:30570998-30571020 TGAACATGACTATTTTTAAAAGG - Intronic
1107882705 13:44846546-44846568 TGAATACAACTTAGTTTTAATGG - Intergenic
1109793525 13:67279765-67279787 TTAATATGATTAGATGTTAAAGG - Intergenic
1109914279 13:68960154-68960176 GGAATATCACTAGGTTCTCATGG + Intergenic
1110608149 13:77457843-77457865 TGAATGTGGCTAGGTTTCAGAGG - Intergenic
1111427383 13:88104682-88104704 TGAGTATGAACATGTTTTAATGG - Intergenic
1112774833 13:102832867-102832889 AGAAGGTGACTAAGTTTTAATGG + Intronic
1114039199 14:18660623-18660645 TGGACATGAGTAGGTTTAAAAGG - Intergenic
1114402322 14:22421227-22421249 TAAGAATGACTAGGTTTTATAGG + Intergenic
1117591800 14:57277363-57277385 TGAATATTATTAAATTTTAATGG + Intronic
1118342858 14:64910451-64910473 TGAATGTGGCTAGATTTAAATGG + Intergenic
1118458620 14:65967370-65967392 TGCATATGACTAGGCATTGAAGG - Intronic
1121608130 14:95256271-95256293 TGAATAGAACTGGGTTTTAAAGG - Intronic
1123801909 15:23830360-23830382 TCAAAATCACTAGGTTTAAATGG - Intergenic
1125250879 15:37701882-37701904 TGAAAATGAATATATTTTAATGG - Intergenic
1125610020 15:40963622-40963644 TGAATATGATTAGGTTTTTATGG - Intergenic
1126562645 15:50060335-50060357 TGAATATGAGTAGATTTTTTGGG - Intronic
1130041152 15:80405776-80405798 TGGATGTGACCAGGCTTTAAAGG + Intronic
1131135672 15:89933383-89933405 TGGATAGGACTAAGTTTTCAAGG - Intergenic
1133401721 16:5492516-5492538 TGAAGATGAAGAGATTTTAATGG + Intergenic
1133938298 16:10286108-10286130 TAAAGGTGATTAGGTTTTAATGG - Intergenic
1134114083 16:11535093-11535115 TGAATATGACCTGGTCCTAATGG - Intergenic
1134403398 16:13933341-13933363 TAAATATCACTAGTTTTTTAAGG + Intronic
1135245713 16:20855271-20855293 TGAATATGACTAGGTTTTAAAGG - Exonic
1137137854 16:36995044-36995066 TGATTATGTCTAGTTTTTATAGG - Intergenic
1138366692 16:56484538-56484560 TGAATAATACTAGGTTTTTATGG - Exonic
1139032572 16:62903535-62903557 TGAAAATGACAAGGTTTTCTTGG - Intergenic
1140052561 16:71495085-71495107 TGAATATGGCTGGGTATTAGGGG - Intronic
1140493753 16:75364800-75364822 TAAATATCAATAGGTATTAAGGG + Intronic
1142843903 17:2656682-2656704 TGAATATGACCTGATTTTAAGGG + Intronic
1143577106 17:7800489-7800511 TTGATATGACTAGATTTTTAAGG + Intronic
1146198553 17:30834247-30834269 AGAATATTACTAGGTTTTGGTGG - Exonic
1149310649 17:55389768-55389790 TATTTATGACTGGGTTTTAAAGG - Intergenic
1150169168 17:62973909-62973931 TGAATATGGCTAAGTTCCAATGG - Intergenic
1154144796 18:11858462-11858484 TGCATATGATTACATTTTAAAGG - Intronic
1155909442 18:31491449-31491471 TGAATATATCTAGATGTTAAAGG + Intergenic
1159259278 18:65990851-65990873 TGGAGATGACTGGGTTTTCATGG + Intergenic
1159904894 18:74080879-74080901 TGAATGTGACTGTCTTTTAAAGG - Intronic
1163995836 19:21046361-21046383 TGAATTTGATTATGTTTTCATGG + Intronic
1164058544 19:21644557-21644579 TGAATAAAACTAGGAATTAAAGG - Intergenic
1164219304 19:23179038-23179060 TAAGTGTGATTAGGTTTTAATGG - Intergenic
1164300197 19:23955399-23955421 AGAATATGCCTACTTTTTAATGG + Intergenic
1165983238 19:39744384-39744406 AGAATATTAATAAGTTTTAAAGG - Intergenic
1166916897 19:46201644-46201666 TAAGGATGATTAGGTTTTAATGG + Intergenic
1168488521 19:56786684-56786706 TGAATTTCACTAAGTTTTAAGGG + Intronic
926647902 2:15309795-15309817 TGAAAAAGACAAGTTTTTAATGG - Intronic
927815346 2:26210913-26210935 TTAATATCACTAGGATATAATGG + Intronic
928015468 2:27652592-27652614 TGCATATTGCTATGTTTTAAAGG + Exonic
929105575 2:38362136-38362158 AGAATAAGAATAGGTTTAAAGGG + Intronic
930407495 2:50978209-50978231 TGTATAAGAATAAGTTTTAATGG - Intronic
931567525 2:63629992-63630014 TAAATCTGACAAGGATTTAAAGG + Intronic
932078280 2:68687053-68687075 TAAATGTGGTTAGGTTTTAATGG - Intronic
932148127 2:69342693-69342715 TGATTATGACTATGTTGTAGAGG + Intronic
932295973 2:70623581-70623603 TAAGTGTGATTAGGTTTTAATGG - Intronic
933151021 2:78915458-78915480 TGAATATGTCTAGATTATATTGG - Intergenic
933346618 2:81094432-81094454 TGAATATGCCAAGGATTTAAAGG - Intergenic
934611190 2:95737959-95737981 AGAATATTACTTGTTTTTAAAGG + Intergenic
936544520 2:113379546-113379568 AGAATATTACTTGTTTTTAAAGG + Intergenic
936823141 2:116548471-116548493 TGATTCTGAATAGGCTTTAAAGG - Intergenic
937594876 2:123660869-123660891 TAAGGATGATTAGGTTTTAATGG + Intergenic
938271403 2:129975337-129975359 TGGACATGAGTAGGTTTAAAAGG + Intergenic
938514356 2:131987319-131987341 AGAATATGAATTGATTTTAAAGG + Intergenic
939940804 2:148348425-148348447 TGAATATGAGAAGGCTTCAAAGG - Intronic
940508660 2:154585994-154586016 TAAGGATGATTAGGTTTTAAGGG + Intergenic
941263475 2:163327877-163327899 TGAATGGGACAAGGTGTTAATGG - Intergenic
941939739 2:171021575-171021597 TGTAGAAGACTAGGTTTAAAAGG - Intronic
941990539 2:171551994-171552016 TGAATAGGAATAGGTGATAAGGG + Intronic
947562205 2:231165664-231165686 GGTATTTGACTTGGTTTTAAAGG - Intronic
1170356802 20:15501169-15501191 TGAAGATAACTGGCTTTTAAAGG - Intronic
1171074639 20:22110210-22110232 TGAATATGAATAAGCTTAAAAGG + Intergenic
1171142746 20:22757254-22757276 AGAATAAGACTGGGTTTGAATGG + Intergenic
1171244338 20:23598696-23598718 TGATGATGAATAGATTTTAAAGG + Intergenic
1171585379 20:26515554-26515576 TGCTTATGTCTAGGTTTTATGGG - Intergenic
1171585730 20:26520650-26520672 TGCTTATGTCTAGGTTTTATGGG - Intergenic
1171590875 20:26600292-26600314 TGCTTATGTCTAGGTTTTATGGG + Intergenic
1172932340 20:38595472-38595494 TAAGGATGATTAGGTTTTAATGG + Intergenic
1175355309 20:58361319-58361341 TTAATATGGATAGATTTTAATGG + Exonic
1176691320 21:9913989-9914011 TGAATATGCCTAGCATTTTATGG - Intergenic
1177977064 21:27864616-27864638 AGAATATGAATTGATTTTAAAGG - Intergenic
949564670 3:5233794-5233816 TATTTATGACTAGTTTTTAATGG - Intergenic
949702312 3:6773495-6773517 TGAAGATGAGTAGGTCTGAATGG + Intronic
949734785 3:7159609-7159631 TGAATATGACTATTTCCTAATGG + Intronic
953290582 3:41657220-41657242 GTAATATGACTAAGTTTTGAGGG + Intronic
953712669 3:45287825-45287847 TGAATCTGACTAGGTAGAAAAGG + Intergenic
955667037 3:61360841-61360863 TTTATATGACTAGGTTTTAATGG + Intergenic
956377861 3:68634982-68635004 TGTTAATGACTAGATTTTAAAGG - Intergenic
957451562 3:80387830-80387852 TAAGCATGATTAGGTTTTAATGG - Intergenic
957675131 3:83355922-83355944 TAAAGGTGATTAGGTTTTAATGG + Intergenic
963456538 3:145553945-145553967 TAAGCATGATTAGGTTTTAATGG + Intergenic
963521739 3:146365007-146365029 TAAGAATGATTAGGTTTTAATGG - Intergenic
963962891 3:151329617-151329639 TAAATATGAAGAGGTTCTAATGG - Intronic
965113366 3:164455996-164456018 TGAATATGAAAACCTTTTAATGG + Intergenic
965532992 3:169793830-169793852 TGAATATGCCTAGGATTTTTAGG + Exonic
965627947 3:170700667-170700689 TGAATAAAAATAGGTTTTAAAGG + Intronic
967630288 3:191737477-191737499 TGAGTAGGACTAGGTTTTATTGG + Intergenic
973088283 4:46097309-46097331 TGAAGATGATGAGGATTTAACGG - Exonic
974776060 4:66483167-66483189 AAAATTTGACTAAGTTTTAATGG + Intergenic
974894735 4:67925861-67925883 TGAATATAACCGGATTTTAAGGG + Intronic
976100519 4:81557900-81557922 TGCATATAACTAGTTTTAAAAGG + Intronic
976600054 4:86929821-86929843 TAAATATGACTTGGTAATAATGG + Intronic
976999217 4:91475145-91475167 TGTAAGTGACTATGTTTTAAAGG + Intronic
979271024 4:118761648-118761670 TGAATTTGAATATGTTTTGAGGG + Intronic
979591966 4:122491134-122491156 TCAATTTGACTAGAGTTTAAAGG - Intergenic
980301156 4:130996787-130996809 TGAATAAGACAGGGTTTTACTGG - Intergenic
980363908 4:131774176-131774198 TGAATATGCCTAGCATTTTATGG - Intergenic
980714534 4:136613228-136613250 TAAGGGTGACTAGGTTTTAATGG - Intergenic
980727475 4:136783234-136783256 TCAATATGAATAGGTATCAAGGG + Intergenic
981032725 4:140141723-140141745 AGAACATTACTAGTTTTTAAAGG - Intronic
981793863 4:148572377-148572399 TAAATATGACTACATGTTAATGG + Intergenic
982143393 4:152353432-152353454 TGAAAATTACTATGTTTTAAAGG - Intronic
983115865 4:163815227-163815249 TGATTATCACTAGGATTTTAGGG - Intronic
983346447 4:166532297-166532319 ATAATTTGACTAGATTTTAATGG - Intergenic
984303876 4:177961955-177961977 TGATTATGTCTGTGTTTTAAAGG + Intronic
984537554 4:180995602-180995624 TAAATGTGACTAGATTTTAAAGG + Intergenic
984660649 4:182371134-182371156 TGAAAATGACTAGGGCTAAAAGG - Intronic
984870519 4:184320736-184320758 TTTATAGGACTAGGTATTAATGG - Intergenic
985078883 4:186244874-186244896 TAAGTGTGATTAGGTTTTAATGG + Intronic
985679985 5:1250836-1250858 TGAAAATAACAAAGTTTTAAAGG - Intergenic
986701166 5:10410080-10410102 TGCATATGACTACTATTTAATGG - Intronic
987396011 5:17424323-17424345 GGAATATGAGTAGGTTTTGTTGG - Intergenic
989730856 5:44646643-44646665 TAAATATGAATAGGTATTTAGGG + Intergenic
990344818 5:54861850-54861872 TGAACATGACTGGTATTTAAAGG - Intergenic
992039362 5:72814559-72814581 TAAATATATCTATGTTTTAAAGG + Intergenic
992320402 5:75607991-75608013 TGAACAGGACCTGGTTTTAAAGG + Intergenic
992744870 5:79809638-79809660 TGAAAATGCTTTGGTTTTAAAGG + Intergenic
993419086 5:87677527-87677549 TCAACAAGACTAGGATTTAATGG + Intergenic
995237881 5:109851062-109851084 TGAATAGGAAGAGATTTTAATGG + Intronic
995305153 5:110638219-110638241 TGAATATAAATATGTTTTGAGGG + Exonic
998742617 5:145222141-145222163 TGAATATGAAGAGGATTGAATGG + Intergenic
999349463 5:150854945-150854967 TGAATATGACTTTTTCTTAATGG + Intronic
999888685 5:155952766-155952788 TGCAAATGACTAGGTTTGAAAGG - Intronic
1002610828 5:180417487-180417509 TGAGGGTGATTAGGTTTTAATGG + Intergenic
1005713667 6:28526280-28526302 TGAATATGACTAGGGAAGAAAGG + Intronic
1008149594 6:47934302-47934324 TGAATAAGACAGGGTTTTACTGG - Intronic
1009464456 6:63952827-63952849 TAAGTGTGATTAGGTTTTAATGG - Intronic
1010071600 6:71751312-71751334 TAAGGATGATTAGGTTTTAATGG + Intergenic
1010378382 6:75201482-75201504 TGATTATGCCAAGGTTTTCAAGG - Intronic
1014301305 6:119685041-119685063 TTAATATGAATTGTTTTTAAGGG - Intergenic
1017779215 6:157703416-157703438 TGAGAGTGATTAGGTTTTAATGG + Intronic
1020647051 7:10827242-10827264 TGAACATGACTAAATTTAAAGGG + Intergenic
1022763376 7:33381498-33381520 TGGATAAGACTAGATTTAAAAGG + Intronic
1024188784 7:46983673-46983695 TGAATATAATTTGGTTTTACGGG + Intergenic
1024224597 7:47316025-47316047 TGAATATGACTGTGTATTTATGG - Intronic
1024434422 7:49333179-49333201 AGAATGTGACTAGTTTTCAAGGG - Intergenic
1027027209 7:74862067-74862089 TTAATGTGACGAGGTTTCAATGG - Intergenic
1027060543 7:75082036-75082058 TTAATGTGACGAGGTTTCAATGG + Intergenic
1028265069 7:88713601-88713623 AGAATATGACCTGGTTTTAATGG + Intergenic
1028742720 7:94294466-94294488 TGACTATGAATTGGTTTTGATGG + Intergenic
1031350525 7:120725023-120725045 TGATTATGGCAAGGCTTTAAAGG - Intronic
1031833713 7:126656858-126656880 TGAATATGCCTAGCTTTTAAAGG - Intronic
1032098647 7:128954350-128954372 TGGAAATGACTTGATTTTAAGGG - Exonic
1032233848 7:130102341-130102363 TTAATATGAGTAGGTGATAAAGG + Intronic
1032622597 7:133552032-133552054 TGAATATAAATATGTTTTCATGG + Intronic
1032762973 7:134961941-134961963 TAAATTTCATTAGGTTTTAAAGG - Intronic
1035981512 8:4377473-4377495 TCAATTTGACTATATTTTAAAGG + Intronic
1038151777 8:24948077-24948099 TGAAAATAACTGGGTTTAAATGG + Intergenic
1038352910 8:26796836-26796858 TGCATATGGCTTTGTTTTAAAGG + Intronic
1039635644 8:39161871-39161893 TAAATATGACTAAGTTTCCAGGG + Intronic
1041147510 8:54893033-54893055 TGAATATGAGTCTTTTTTAAAGG - Intergenic
1041168740 8:55118693-55118715 TGAATATGACTTGCGTTGAAAGG + Intronic
1041651726 8:60309266-60309288 TAAGGATGATTAGGTTTTAATGG + Intergenic
1042414952 8:68508839-68508861 TGAATAAGACAGGGTTTTATTGG + Intronic
1043064584 8:75551678-75551700 TGAACAAGACTAGTTTTAAATGG + Intronic
1046094612 8:109542013-109542035 TAAATATACCTAGGTTTGAATGG + Intronic
1046185117 8:110703437-110703459 TGCATAAGGCTAGGTTTTATGGG + Intergenic
1046329645 8:112698307-112698329 TGAATATAACTAGATATAAATGG + Intronic
1046346855 8:112940587-112940609 AGAATATAACAAGTTTTTAAAGG - Intronic
1046934350 8:119872306-119872328 TGAGTATGGCCAGGGTTTAAGGG + Intergenic
1050226735 9:3466440-3466462 TGCATATGGCTAGGTTGTACGGG + Intronic
1050296816 9:4213341-4213363 AGAATATGTACAGGTTTTAAAGG - Intronic
1050674809 9:8039898-8039920 TGAACATGCCTAGGTCTTAATGG - Intergenic
1050827261 9:9963484-9963506 TGAAAATGACTGGATTGTAATGG + Intronic
1052620592 9:30903908-30903930 TCAATTTGACTAGATTATAATGG - Intergenic
1053628252 9:39900060-39900082 TGAATATGCCTAGCATTTTATGG - Intergenic
1053777806 9:41566267-41566289 TGAATATGCCTAGCATTTTATGG + Intergenic
1054215635 9:62350641-62350663 TGAATATGCCTAGCATTTTATGG + Intergenic
1054364246 9:64316156-64316178 TGAATATGCCTAGCATTTTATGG - Intergenic
1054671846 9:67804709-67804731 TGAATATGCCTAGCATTTTATGG - Intergenic
1055221924 9:73945534-73945556 TAAATATCACTTTGTTTTAATGG - Intergenic
1055307001 9:74940471-74940493 AGAATGTGACTAGTTTTCAAGGG - Intergenic
1055845785 9:80561568-80561590 TGAATATGTCTCAGTTATAAAGG + Intergenic
1056363830 9:85883635-85883657 TAAGGATGATTAGGTTTTAATGG - Intergenic
1058291955 9:103253613-103253635 TGTATCTGACTTTGTTTTAAAGG + Intergenic
1186235549 X:7504806-7504828 TGCATTTGACAAAGTTTTAAAGG - Intergenic
1188463757 X:30455040-30455062 AGAATATGACTATTTTTTGAAGG - Intergenic
1190951164 X:55144550-55144572 TGAATATGGGTAGGATTTTAAGG - Intronic
1192356620 X:70410069-70410091 TGAATATAACTGGGCTTTAAAGG + Intronic
1192764457 X:74127563-74127585 TAAGAGTGACTAGGTTTTAATGG + Intergenic
1193033197 X:76921923-76921945 TGAAGATGACAAGGTTTAAAGGG + Intergenic
1193886050 X:86984747-86984769 TAAAGGTGATTAGGTTTTAATGG - Intergenic
1194187316 X:90789471-90789493 TGCATATTTCTGGGTTTTAAGGG - Intergenic
1194419785 X:93659660-93659682 TAAATATCAGTAGGTTTTGATGG + Intergenic
1196765809 X:119241782-119241804 TGAATATGAGTAGGAATTAGAGG - Intronic
1197463856 X:126779312-126779334 TACATATGAATAGTTTTTAATGG - Intergenic
1198776916 X:140189578-140189600 TGAAAATGACTAGATTTTAATGG + Intergenic
1198802504 X:140461939-140461961 TGCCTATGAGAAGGTTTTAAAGG + Intergenic
1199181415 X:144858895-144858917 TGAATTATAGTAGGTTTTAATGG - Intergenic
1200533911 Y:4371428-4371450 TGCATATTTCTGGGTTTTAAAGG - Intergenic
1200768458 Y:7101817-7101839 AGAATATGACATGGTTTAAAAGG + Intergenic